Browse matrices

Showing page 5/13: Entry 101 - 125 of 307
Accession Name Consensus Sequence Organism
MX000120 CpxR (7-mer)
NGTAAAN
Escherichia coli str. K-12 substr. MG1655, complete genome.
MX000121 CytR
NNNAAAYWNNNW
Escherichia coli str. K-12 substr. MG1655, complete genome.
MX000122 DnaA-ATP
AGWTYW
Escherichia coli str. K-12 substr. MG1655, complete genome.
MX000123 DeoR
TGTDAGAATHBTAWCA
Escherichia coli str. K-12 substr. MG1655, complete genome.
MX000124 FadR
MRCTGRTMNGWYNWNNW
Escherichia coli str. K-12 substr. MG1655, complete genome.
MX000125 FruR
GCTGAAWCGNTWMW
Escherichia coli str. K-12 substr. MG1655, complete genome.
MX000126 FlhD2C2
HWAABSBSWVRRKYMSB
Escherichia coli str. K-12 substr. MG1655, complete genome.
MX000127 FhlA
WTTTCGW
Escherichia coli str. K-12 substr. MG1655, complete genome.
MX000128 Fur
NNNARTKAWAAYNATWNTY
Escherichia coli str. K-12 substr. MG1655, complete genome.
MX000129 GalR
TGKHARCGDTTMC
Escherichia coli str. K-12 substr. MG1655, complete genome.
MX000130 GalS
TGKMAMCGBTTYCM
Escherichia coli str. K-12 substr. MG1655, complete genome.
MX000131 EmrR
ACTTTATTTGTCACTGTCGTTACTATATCGGCTGAAATTAAT
Escherichia coli str. K-12 substr. MG1655, complete genome.
MX000132 FliA
TNAASWYNNNBNNNNNNNNGCCGATAA
Escherichia coli str. K-12 substr. MG1655, complete genome.
MX000133 GntR
RYNTTMMSSVWWAMMW
Escherichia coli str. K-12 substr. MG1655, complete genome.
MX000134 IciA
NGATHWNBHNDN
Escherichia coli str. K-12 substr. MG1655, complete genome.
MX000135 YhiX
WHMGNNWWWNDHWWYWWT
Escherichia coli str. K-12 substr. MG1655, complete genome.
MX000136 IlvY
AYRTWKCAAWWWYYGCAATRWRWYKYY
Escherichia coli str. K-12 substr. MG1655, complete genome.
MX000137 LacI
RRHWGTGAGCGVRWMRCAAYY
Escherichia coli str. K-12 substr. MG1655, complete genome.
MX000138 MalI
GATAAAACGTTTTA
Escherichia coli str. K-12 substr. MG1655, complete genome.
MX000139 MalT
GGAKGA
Escherichia coli str. K-12 substr. MG1655, complete genome.
MX000140 LexA
CTGKWWRWWNAWMCAG
Escherichia coli str. K-12 substr. MG1655, complete genome.
MX000141 OmpR (C box)
WGWADCAYHT
Escherichia coli str. K-12 substr. MG1655, complete genome.
MX000142 OmpR (F box)
KTTWCWTWTK
Escherichia coli str. K-12 substr. MG1655, complete genome.
MX000143 GcvA
CTAAT
Escherichia coli str. K-12 substr. MG1655, complete genome.
MX000144 MarR
WWWWRTTGCCCWGGCAAGTAWWW
Escherichia coli str. K-12 substr. MG1655, complete genome.