Browse matrices

Showing page 6/13: Entry 126 - 150 of 307
Accession Name Consensus Sequence Organism
MX000145 MetJ
RGACRTCNARAYKWMY
Escherichia coli str. K-12 substr. MG1655, complete genome.
MX000146 MetJ (Selex: holo-repressor)
AGACGTCTAGAYGKCY
Escherichia coli str. K-12 substr. MG1655, complete genome.
MX000147 MetJ (Selex: apo-repressor)
AGACGTCTAGAYGKCY
Escherichia coli str. K-12 substr. MG1655, complete genome.
MX000148 ModE
CGHTRTATWVWHRHHTWYATARC
Escherichia coli str. K-12 substr. MG1655, complete genome.
MX000149 Nac
ATMWDMAWHWY
Escherichia coli str. K-12 substr. MG1655, complete genome.
MX000150 NagC
NWTWWTWYAYNWWTCGAAAWWWN
Escherichia coli str. K-12 substr. MG1655, complete genome.
MX000151 NhaR
TMSKWAWAAHV
Escherichia coli str. K-12 substr. MG1655, complete genome.
MX000152 GlnG
TGSYSY
Escherichia coli str. K-12 substr. MG1655, complete genome.
MX000153 OmpR
KAAAAMW
Escherichia coli str. K-12 substr. MG1655, complete genome.
MX000154 OxyR
NNDWNNNWNYNMYNNNWNNNATNRNWNNNNNMWW
Escherichia coli str. K-12 substr. MG1655, complete genome.
MX000155 OxyR (SELEX)
ACGATAGRNRNNRNNNNNNNNNNNNWNNNKNNNYNYCKATTATCCG
Escherichia coli str. K-12 substr. MG1655, complete genome.
MX000156 MngR
TAATACRAATWYAA
Escherichia coli str. K-12 substr. MG1655, complete genome.
MX000157 PdhR
YYAAWH
Escherichia coli str. K-12 substr. MG1655, complete genome.
MX000158 MetR
TGAAVAA
Escherichia coli str. K-12 substr. MG1655, complete genome.
MX000160 RcsA-RcsB
TNRKAAWWNYMYNN
Escherichia coli str. K-12 substr. MG1655, complete genome.
MX000161 NagC (Selex)
STTRRTTCRYRNYRCRAAWTAAG
Escherichia coli str. K-12 substr. MG1655, complete genome.
MX000162 Mlc (Selex)
WTATTTYRNRSNNYGAAATRA
Escherichia coli str. K-12 substr. MG1655, complete genome.
MX000163 Lrp (SELEX)
NNNNNYAGNRNWTTNTNCTRBNNNY
Escherichia coli str. K-12 substr. MG1655, complete genome.
MX000164 Lrp + Leucin (SELEX)
BNNNMNMAGNNNWTTMTVCYRYSNN
Escherichia coli str. K-12 substr. MG1655, complete genome.
MX000165 MarA
ANNRCAMNNWNNRYYMWNHN
Escherichia coli str. K-12 substr. MG1655, complete genome.
MX000166 RcsB
TTGAAGATTCATCTG
Escherichia coli str. K-12 substr. MG1655, complete genome.
MX000169 NarP
TACNHHH
Escherichia coli str. K-12 substr. MG1655, complete genome.
MX000170 Rob
RNNGCWMDNWNNRYYAMNNN
Escherichia coli str. K-12 substr. MG1655, complete genome.
MX000171 RhaS
WTMWTKCCSTGRTTGCCARTRRMYCRWYWWCSKSKSMRWMASGMGAARG
Escherichia coli str. K-12 substr. MG1655, complete genome.
MX000172 RhaR
ATCTTGAAAAATCGACGTTTTTTACGTGGTTTTCCGTCGAAAATTTAAGGT
Escherichia coli str. K-12 substr. MG1655, complete genome.