Browse matrices

Showing page 7/13: Entry 151 - 175 of 307
Accession Name Consensus Sequence Organism
MX000173 SoxR
TCCTCAAGTTAACTTGAGG
Escherichia coli str. K-12 substr. MG1655, complete genome.
MX000174 SoxS
RNNGCAYDNWNNNNNAWNNN
Escherichia coli str. K-12 substr. MG1655, complete genome.
MX000175 SdiA
WWYKWYRAWWRTRRKRSSARRWAWYKCTCT
Escherichia coli str. K-12 substr. MG1655, complete genome.
MX000177 TreR
YSGKWWCSTKMMCG
Escherichia coli str. K-12 substr. MG1655, complete genome.
MX000178 TorR
CYGTTCAT
Escherichia coli str. K-12 substr. MG1655, complete genome.
MX000179 XapR
CCAATACASTTTT
Escherichia coli str. K-12 substr. MG1655, complete genome.
MX000180 HydG
ATAAACGAGTAAAAATGACTCGCCTGCTGCGGGTAGCGAGTCATTTTTACTCATTG
Escherichia coli str. K-12 substr. MG1655, complete genome.
MX000181 Crp (22mer)
DWTNTGMWVHWNNNNWMAMRWH
Escherichia coli str. K-12 substr. MG1655, complete genome.
MX000182 TyrR
TGTAWNNWWNNNTWKACR
Escherichia coli str. K-12 substr. MG1655, complete genome.
MX000183 TrpR
YGTACTMGTKWRCTRGTDCR
Escherichia coli str. K-12 substr. MG1655, complete genome.
MX000184 YiaJ
GTTAAAAAGTGATCGATATATTTGAAATCAAGTTT
Escherichia coli str. K-12 substr. MG1655, complete genome.
MX000185 XylR
AWWWAHYDMWAWWBSHVWKHRMWRBMWVAHAAT
Escherichia coli str. K-12 substr. MG1655, complete genome.
MX000187 LsrR
TGTGATSKMWWCSWCR
Escherichia coli str. K-12 substr. MG1655, complete genome.
MX000200 MelR
WTYYSHKKWWWWKSRRAW
Escherichia coli str. K-12 substr. MG1655, complete genome.
MX000201 LeuO
WSKATWAWT
Escherichia coli str. K-12 substr. MG1655, complete genome.
MX000204 MurR
KGAKWY
Escherichia coli str. K-12 substr. MG1655, complete genome.
MX000219 NagC
ATTTTATTTNWCAAAAAAAAT
Escherichia coli str. K-12 substr. MG1655, complete genome.
MX000220 ChbR
AGGTCAARGARAWACWATT
Escherichia coli str. K-12 substr. MG1655, complete genome.
MX000223 PurR
ACGGAAACGGTTTCCT
Escherichia coli str. K-12 substr. MG1655, complete genome.
MX000224 NsrR
AARWKGYATTTAAAATRCAWMTT
Escherichia coli str. K-12 substr. MG1655, complete genome.
MX000235 EvgA
KKYYKACWGCYGTWWGA
Escherichia coli str. K-12 substr. MG1655, complete genome.
MX000236 SlyA
TTATAAATTWAA
Escherichia coli str. K-12 substr. MG1655, complete genome.
MX000237 RelB
TGTAA
Escherichia coli str. K-12 substr. MG1655, complete genome.
MX000240 IHF
AKWYWSSKRATTKKYWKAWATTT
Escherichia coli CFT073 chromosome, complete genome.
MX000241 Fis
CTSWTTTTTGC
Escherichia coli CFT073 chromosome, complete genome.