Browse matrices

Showing page 4/13: Entry 76 - 100 of 307
Accession Name Consensus Sequence Organism
MX000196 YvaN
DTTDAC
Bacillus subtilis subsp. subtilis str. 168 chromosome, complete genome.
MX000197 NatA
TYMSSRM
Bacillus subtilis subsp. subtilis str. 168 chromosome, complete genome.
MX000198 YrzC
WAAYVMMWAKDMWWHTWRKMGKWW
Bacillus subtilis subsp. subtilis str. 168 chromosome, complete genome.
MX000206 AbrB
NNNWNNWNN
Bacillus subtilis subsp. subtilis str. 168 chromosome, complete genome.
MX000211 SdpR
WSAAAWW
Bacillus subtilis subsp. subtilis str. 168 chromosome, complete genome.
MX000212 Abh
YYTWTCAAWAWAYAKRWWTKGWWKTARTAMWYTRA
Bacillus subtilis subsp. subtilis str. 168 chromosome, complete genome.
MX000213 SigM
TGAAACCTTTTAGTCTTTTATTCCGTCT
Bacillus subtilis subsp. subtilis str. 168 chromosome, complete genome.
MX000214 DegU
ACAGAAATATAAWBAATTTYTG
Bacillus subtilis subsp. subtilis str. 168 chromosome, complete genome.
MX000215 CcpA
TGAAAGCGTTTTCA
Bacillus subtilis subsp. subtilis str. 168 chromosome, complete genome.
MX000216 YodB
TACTATWWRWAAGTA
Bacillus subtilis subsp. subtilis str. 168 chromosome, complete genome.
MX000217 YycF
TGTAAC
Bacillus subtilis subsp. subtilis str. 168 chromosome, complete genome.
MX000222 LmrA/YxaF
AWTATATAGACYGGTCTA
Bacillus subtilis subsp. subtilis str. 168 chromosome, complete genome.
MX000225 YkvE
TATCTYGAAWTCGAGATA
Bacillus subtilis subsp. subtilis str. 168 chromosome, complete genome.
MX000226 CcpC
ATAAGTW
Bacillus subtilis subsp. subtilis str. 168 chromosome, complete genome.
MX000227 PhoP
TTMAWWTCCTTANATAAAA
Bacillus subtilis subsp. subtilis str. 168 chromosome, complete genome.
MX000228 TnrA
TATATTTTCTR
Bacillus subtilis subsp. subtilis str. 168 chromosome, complete genome.
MX000229 ComA
WWTTGGGCRAAAANTTTCAN
Bacillus subtilis subsp. subtilis str. 168 chromosome, complete genome.
MX000230 GerE
TATAGGCTATW
Bacillus subtilis subsp. subtilis str. 168 chromosome, complete genome.
MX000231 CcpN
TATKTTATAC
Bacillus subtilis subsp. subtilis str. 168 chromosome, complete genome.
MX000232 NatR
TTCRCGACA
Bacillus subtilis subsp. subtilis str. 168 chromosome, complete genome.
MX000233 YrkP
TTCATAAATT
Bacillus subtilis subsp. subtilis str. 168 chromosome, complete genome.
MX000040 Sigma(54)
NNNNNNNNNNNNNNNNHNNNNNNNTGGCAHRVNNNHTGCWNNNNNNNNNN
Bradyrhizobium japonicum USDA 110 chromosome, complete genome.
MX000042 RegR
GCKRCRTYRKGWCGC
Bradyrhizobium japonicum USDA 110 chromosome, complete genome.
MX000111 RpoN
NNNNNNNNNNNNNYNNSNNNNTGGCAYRNNNSYTGCTNNKNNNBNN
Bradyrhizobium japonicum USDA 110 chromosome, complete genome.
MX000259 Fur
GCCAGATGCAGTTGCRARWRASTTGCAWYTGMAKCTW
Bradyrhizobium japonicum USDA 110 chromosome, complete genome.