Browse matrices

Showing page 1/13: Entry 1 - 25 of 307
Accession Name Consensus Sequence Organism
MX000307 CRE
ATTTTGAWAACGYTWTCAAAGT
Bacillus megaterium DSM 319 chromosome, complete genome.
MX000306 CcpA
YCCTGAAGAWKTTGAAAGCGCTAACAMRRTGAAAGATCAGCTGCGTTT
Bacillus megaterium DSM 319 chromosome, complete genome.
MX000305 ArgR
ATTTTCSMTTTMWCATCGMRYTWYTCMTTYYTGTTTTAAGCTGTACATGTAACA
Bacillus licheniformis DSM 13 = ATCC 14580 chromosome, complete genome.
MX000304 Pen
AGTATTACATWTGTAAGWWTWRRATG
Bacillus licheniformis DSM 13 = ATCC 14580 chromosome, complete genome.
MX000303 XylR
GAAGTTRRTTWAATGRTTAWACAAAMWTT
Bacillus licheniformis DSM 13 = ATCC 14580 chromosome, complete genome.
MX000302 OxyR
GACGRGYYKSGMMAGWTCRSSKTYKWSRTGAMRA
Rhodobacter sphaeroides 2.4.1 chromosome 2, complete sequence.
MX000301 LexA
AACAACACCCAGAACCTAGTAACTAGTTMGWCCTAAANTCCTTHCTTCA
Synechocystis sp. PCC 6803, complete genome.
MX000300 Crp
TGTGATCHAGATCACA
Synechocystis sp. PCC 6803 chromosome, complete genome.
MX000299 LexA
CGAACATATGTTCK
Staphylococcus aureus subsp. aureus COL chromosome, complete genome.
MX000298 SigK
GTATAATAAGTAACAAATWTTATAWTTTATACATATTATATAWTAAA
Clostridium difficile 630, complete genome.
MX000297 SigH
AAAAAGGAATTATAANWTAWAATATAGAATTA
Clostridium difficile 630, complete genome.
MX000296 SigG
WWTAWATGAATAAAATTTTTTAAATTGGAAATAATAATTWTAAATATTGGTAD
Clostridium difficile 630, complete genome.
MX000295 SigF
WWMATGTATAAAAWACATAAAAATKGTAAAAAATWAAAATAR
Clostridium difficile 630, complete genome.
MX000294 SigE (42-mer)
TAAAAGTAATAAATTTGTAATAATATGMATATWAWTTTAWTA
Clostridium difficile 630, complete genome.
MX000293 SigE (51-mer)
CWTTTTAGTAATATATTATWTTTTTTATACATATATTTATATAATAGTTTA
Clostridium difficile 630, complete genome.
MX000292 SigD
ATAAAKATAWTAWATTATTTAWGCGATAAT
Clostridium difficile 630, complete genome.
MX000291 SigB
TAAAATGTTTTATAAATTTTAAAAAWGGGTATAATAATAATAA
Clostridium difficile 630, complete genome.
MX000290 LexA
SRGAACRSGSGSWGAACMR
Rhodobacter sphaeroides 2.4.1 chromosome 1, complete sequence.
MX000289 VqsR
TCGCCAVGGGHBCGGCGA
Pseudomonas aeruginosa PAO1 chromosome, complete genome.
MX000288 VqsM
GGATCTTTTCGGCCA
Pseudomonas aeruginosa PAO1 chromosome, complete genome.
MX000287 RsaL
TATGAAATTYGCATA
Pseudomonas aeruginosa PAO1 chromosome, complete genome.
MX000286 PtxS
TGAAACSKKTTTYM
Pseudomonas aeruginosa PAO1 chromosome, complete genome.
MX000285 PtxR
CGGCGCGCCG
Pseudomonas aeruginosa PAO1 chromosome, complete genome.
MX000284 PchR
CTGCAGCGAATGAAAAAGCCCCGCAATCGAAA
Pseudomonas aeruginosa PAO1 chromosome, complete genome.
MX000283 OhrR
RCKYCATRCAY
Pseudomonas aeruginosa PAO1 chromosome, complete genome.