Browse matrices

Showing page 1/13: Entry 1 - 25 of 307
Accession Name Consensus Sequence Organism
MX000297 SigH
AAAAAGGAATTATAANWTAWAATATAGAATTA
Clostridium difficile 630, complete genome.
MX000266 CsgD
AAAAGTGATAAATA
Escherichia coli str. K-12 substr. W3110, complete genome.
MX000023 ComK
AAAANNNNNTTTT
Bacillus subtilis subsp. subtilis str. 168 chromosome, complete genome.
MX000280 IscR
AAACCTGAGBTATTTGCTCGGDTAAA
Pseudomonas aeruginosa PAO1 chromosome, complete genome.
MX000014 OmpR
AAACSMATCRTTWAMYAKYGATTRAAT
Helicobacter pylori 26695 chromosome, complete genome.
MX000090 Zur
AAATCGTWATCATTYTRWT
Bacillus subtilis subsp. subtilis str. 168 chromosome, complete genome.
MX000257 Fur
AAATGATAATMAWTATCAA
Clostridium difficile 630, complete genome.
MX000301 LexA
AACAACACCCAGAACCTAGTAACTAGTTMGWCCTAAANTCCTTHCTTCA
Synechocystis sp. PCC 6803, complete genome.
MX000261 CcpA
AAGAAAACGTTTTCTT
Clostridium difficile 630, complete genome.
MX000224 NsrR
AARWKGYATTTAAAATRCAWMTT
Escherichia coli str. K-12 substr. MG1655, complete genome.
MX000270 LexA
AATAAGAACATATGTTCGTTT
Listeria monocytogenes EGD-e chromosome, complete genome.
MX000256 CodY
AATTTTYWGAAACTT
Clostridium difficile 630, complete genome.
MX000250 Rex
AAWCTTTGTTAWWTTWTTAACAAWMWAT
Clostridium acetobutylicum ATCC 824 chromosome, complete genome.
MX000214 DegU
ACAGAAATATAAWBAATTTYTG
Bacillus subtilis subsp. subtilis str. 168 chromosome, complete genome.
MX000155 OxyR (SELEX)
ACGATAGRNRNNRNNNNNNNNNNNNWNNNKNNNYNYCKATTATCCG
Escherichia coli str. K-12 substr. MG1655, complete genome.
MX000223 PurR
ACGGAAACGGTTTCCT
Escherichia coli str. K-12 substr. MG1655, complete genome.
MX000131 EmrR
ACTTTATTTGTCACTGTCGTTACTATATCGGCTGAAATTAAT
Escherichia coli str. K-12 substr. MG1655, complete genome.
MX000168 DegU (N12)
AGAAACAGATAGATTTTTTAG
Bacillus subtilis subsp. subtilis str. 168 chromosome, complete genome.
MX000146 MetJ (Selex: holo-repressor)
AGACGTCTAGAYGKCY
Escherichia coli str. K-12 substr. MG1655, complete genome.
MX000147 MetJ (Selex: apo-repressor)
AGACGTCTAGAYGKCY
Escherichia coli str. K-12 substr. MG1655, complete genome.
MX000030 DegU (N10)
AGADHWDYHARYYMTTYRG
Bacillus subtilis subsp. subtilis str. 168 chromosome, complete genome.
MX000220 ChbR
AGGTCAARGARAWACWATT
Escherichia coli str. K-12 substr. MG1655, complete genome.
MX000304 Pen
AGTATTACATWTGTAAGWWTWRRATG
Bacillus licheniformis DSM 13 = ATCC 14580 chromosome, complete genome.
MX000279 DesT
AGTGAACGMTYGTTSACT
Pseudomonas aeruginosa PAO1 chromosome, complete genome.
MX000122 DnaA-ATP
AGWTYW
Escherichia coli str. K-12 substr. MG1655, complete genome.