Browse matrices

Showing page 3/13: Entry 51 - 75 of 307
Accession Name Consensus Sequence Organism
MX000280 IscR
AAACCTGAGBTATTTGCTCGGDTAAA
Pseudomonas aeruginosa PAO1 chromosome, complete genome.
MX000281 LexA
CACTGTGTATAAATATACAG
Pseudomonas aeruginosa PAO1 chromosome, complete genome.
MX000282 MexT
ATCACCCCTGTCGATAGMTACTAT
Pseudomonas aeruginosa PAO1 chromosome, complete genome.
MX000283 OhrR
RCKYCATRCAY
Pseudomonas aeruginosa PAO1 chromosome, complete genome.
MX000284 PchR
CTGCAGCGAATGAAAAAGCCCCGCAATCGAAA
Pseudomonas aeruginosa PAO1 chromosome, complete genome.
MX000285 PtxR
CGGCGCGCCG
Pseudomonas aeruginosa PAO1 chromosome, complete genome.
MX000286 PtxS
TGAAACSKKTTTYM
Pseudomonas aeruginosa PAO1 chromosome, complete genome.
MX000287 RsaL
TATGAAATTYGCATA
Pseudomonas aeruginosa PAO1 chromosome, complete genome.
MX000288 VqsM
GGATCTTTTCGGCCA
Pseudomonas aeruginosa PAO1 chromosome, complete genome.
MX000289 VqsR
TCGCCAVGGGHBCGGCGA
Pseudomonas aeruginosa PAO1 chromosome, complete genome.
MX000272 DosR
TCGGGGACTAAYGGCCCCAG
Mycobacterium tuberculosis H37Rv, complete genome.
MX000203 DevR
GNNNNWWNNBCCYN
Mycobacterium tuberculosis H37Rv complete genome.
MX000273 IdeR
CCGGWTKWWCRMARYMSRG
Mycobacterium tuberculosis H37Rv complete genome.
MX000274 LexA
TCGAACACATGTTCGATA
Mycobacterium tuberculosis H37Rv complete genome.
MX000275 Zur
CWWTAATGAAAATCATTTTCGATAAGC
Mycobacterium tuberculosis H37Rv complete genome.
MX000018 CtsR
RGTCAAAVWWRGTCARWV
Listeria monocytogenes EGD-e chromosome, complete genome.
MX000060 PrfA
WTAACAWWTGTTAA
Listeria monocytogenes EGD-e chromosome, complete genome.
MX000269 Fur
GATAATGATTATCATTTAG
Listeria monocytogenes EGD-e chromosome, complete genome.
MX000270 LexA
AATAAGAACATATGTTCGTTT
Listeria monocytogenes EGD-e chromosome, complete genome.
MX000271 MogR
TTTTTTTAAAAAAAT
Listeria monocytogenes EGD-e chromosome, complete genome.
MX000014 OmpR
AAACSMATCRTTWAMYAKYGATTRAAT
Helicobacter pylori 26695 chromosome, complete genome.
MX000016 Fur
WWTDMDHHDVWWTTWMWVAWAAT
Helicobacter pylori 26695 chromosome, complete genome.
MX000268 NikR
ATATATTATTAATTCATTTTAAATAATAATTASTT
Helicobacter pylori 26695 chromosome, complete genome.
MX000159 Crp
GMAAMCGKTT
Escherichia coli str. K-12 substr. W3110, complete genome.
MX000218 Lrp
CAGTARSARATKSTST
Escherichia coli str. K-12 substr. W3110, complete genome.