Browse matrices

Showing page 4/13: Entry 76 - 100 of 307
Accession Name Consensus Sequence Organism
MX000238 LsrR
TGTGATSKMWWCSWC
Escherichia coli str. K-12 substr. W3110, complete genome.
MX000239 NemR
ARACCAGTCGGTYT
Escherichia coli str. K-12 substr. W3110, complete genome.
MX000266 CsgD
AAAAGTGATAAATA
Escherichia coli str. K-12 substr. W3110, complete genome.
MX000267 PhoP
TGTTTAKGGTTTGTTTA
Escherichia coli str. K-12 substr. W3110, complete genome.
MX000003 NarL
TAMYNHN
Escherichia coli str. K-12 substr. MG1655, complete genome.
MX000004 Fnr
TTGMTNNNNMWCAA
Escherichia coli str. K-12 substr. MG1655, complete genome.
MX000008 GlpR
WNTGNKCRDWWWYNNNMNNN
Escherichia coli str. K-12 substr. MG1655, complete genome.
MX000029 Fis
GNNNRNNWNNNNNNC
Escherichia coli str. K-12 substr. MG1655, complete genome.
MX000031 PhoP
KGTTTAKNNWYKGTTKA
Escherichia coli str. K-12 substr. MG1655, complete genome.
MX000091 ArcA
WGTTAMWWWW
Escherichia coli str. K-12 substr. MG1655, complete genome.
MX000092 CaiF
KRYTTTCAATATTGGTGAKSMAYWWAACAATATTGAAARTTKSWTT
Escherichia coli str. K-12 substr. MG1655, complete genome.
MX000093 Crp (20mer)
WNNRTGANNNNNNTMAMNNW
Escherichia coli str. K-12 substr. MG1655, complete genome.
MX000094 CysB
NDDDNGWTATNNNNNNNNNHWWNBNMNNHWK
Escherichia coli str. K-12 substr. MG1655, complete genome.
MX000095 MhpR
GGTGCACCTGGTGCACA
Escherichia coli str. K-12 substr. MG1655, complete genome.
MX000096 Lrp
NNNNNNWTTATNNN
Escherichia coli str. K-12 substr. MG1655, complete genome.
MX000097 Mlc
CGMAMW
Escherichia coli str. K-12 substr. MG1655, complete genome.
MX000098 DnaA
TTATYCRCA
Escherichia coli str. K-12 substr. MG1655, complete genome.
MX000099 PhoB
TGWNANNNWNNTNWVW
Escherichia coli str. K-12 substr. MG1655, complete genome.
MX000100 RpoN
NNNNNNWNNVNNNHRHWNHAAARNTGGCAHRMWWNWTGCWTDNWNNWKN
Escherichia coli str. K-12 substr. MG1655, complete genome.
MX000114 Ada
AHMRRAATDWDWDMGCAA
Escherichia coli str. K-12 substr. MG1655, complete genome.
MX000115 AraC
HRTSYATAMDNWBRRNVKRWHHRWCCWBR
Escherichia coli str. K-12 substr. MG1655, complete genome.
MX000116 ArgR
TGMATWWWWATNSN
Escherichia coli str. K-12 substr. MG1655, complete genome.
MX000117 CspA
CCAAT
Escherichia coli str. K-12 substr. MG1655, complete genome.
MX000118 CynR
CCTATAAGTAAATCCAATGGAACTCATCATAAATGAGACTTTTACCTTATGACA
Escherichia coli str. K-12 substr. MG1655, complete genome.
MX000119 CpxR (16-mer)
NGTAAARNNNNGTAAR
Escherichia coli str. K-12 substr. MG1655, complete genome.