Details for MX000003

General Information

MX000003

NarL

b1221

Escherichia coli str. K-12 substr. MG1655, complete genome.

NCBI GenBank BacDive

Frequency Matrix

A 0 54 8 5 9 28 8
T 57 0 7 24 16 12 38
G 0 4 1 5 8 0 7
C 3 2 44 26 27 20 7
Consensus T A M Y N H N

Sequence Logo

Motif List

Motif AccMotif NameBinding SequenceStartEndOrientationPubMed-ID
MF098082 narGHJI operon
AGGGGTA
1279715 1279721 + 8057356
MF098083 narGHJI operon
TAATTAT
1279703 1279709 + 8057356
MF098084 narGHJI operon
TAGGAAT
1279725 1279731 + 8057356
MF098085 narGHJI operon
TACTTTA
1279733 1279739 + 8057356
MF098086 narGHJI operon
TCCCCAT
1279747 1279753 + 8057356
MF098087 narGHJI operon
TACCCAT
1279596 1279602 + 8057356
MF098088 narGHJI operon
TACCCAT
1279619 1279625 + 8057356
MF098089 narGHJI operon
TACTCCT
1279609 1279615 + 8057356
MF098091 narK operon
tatcaat
1277085 1277091 + 8057356
MF098092 narK operon
ataaata
1277072 1277078 + 8057356
MF098093 narK operon
atgggta
1277062 1277068 + 8057356
MF098094 narK operon
TACTCAC
1277831 1277837 + 8057356
MF098095 narK operon
aagggta
1276998 1277004 + 8057356
MF098096 narK operon
atcggta
1276992 1276998 + 8057356
MF098097 narK operon
gtggtta
1276975 1276981 + 8057356
MF098098 narK operon
TACTCCT
1277735 1277741 + 8057356
MF098099 narK operon
TACCCAT
1277715 1277721 + 8057356
MF098101 fdnG operon
aggcgga
1545313 1545319 + 8057356
MF098102 fdnG operon
tgaggta
1545293 1545299 + 8057356
MF098103 fdnG operon
TACCGCT
1547260 1547266 + 8057356
MF098104 fdnG operon
NA
1545266 1545272 + 8057356
MF098105 frdA operon
TATCCAT
4382435 4382441 - 8057356
MF098106 frdA operon
TACTGTT
4382421 4382427 - 8057356
MF098107 frdA operon
TACCTAT
4382413 4382419 - 8057356
MF098108 frdA operon
AGGAGCA
4382404 4382410 - 8057356
MF098109 frdA operon
TGGAATA
4382396 4382402 - 8057356
MF098110 frdA operon
TAACTTT
4382375 4382381 - 8057356
MF098111 frdA operon
TACTTAC
4382364 4382370 - 8057356
MF098119 adhE operon
TACCCAGaaGTGAGTA
1298321 1298336 - 10601216
MF098122 nrfABCDEFG operon
TAACTCTaaAGTGGTA
4287589 4287604 + 7854119
MF098123 nrfABCDEFG operon
TACTGAC
4287582 4287588 + 7854119
MF098124 nrfABCDEFG operon
TACAATT
4287618 4287624 + 7854119
MF098125 nrfABCDEFG operon
TGTGGTT
4287646 4287652 + 7854119
MF098133 nirB operon
taTACCCATtaAGGAGTAta
3493908 3493927 + 7854119
MF098139 moeA operon
TACTCAT
866500 866506 - 11357510
MF098140 moeA operon
TGCCCAT
866568 866574 - 11357510
MF098142 dmsA operon
TACTCCT
940793 940799 + 12079504
MF098143 dmsA operon
TACTACT
940813 940819 + 12079504
MF098144 dmsA operon
TACCTAT
940834 940840 + 12079504
MF098145 dmsA operon
TTGATACCGAACAATAATTACTCCTCACTTACACGTAATACTACTTTCGAGTGAAAATCTACCTATCTCTTTGATT
940775 940850 + 2677602
MF098152 caiF operon
TACCTAC
33846 33852 + 8631699
MF098153 caiF operon
CACCGCG
33963 33969 + 8631699
MF098718 hyaABCDEF operon
TACGCTT
1031971 1031977 + 10537212
MF098719 hyaABCDEF operon
TACTTTC
1031987 1031993 + 10537212
MF098721 hybOABCDEFG operon
TACACTA
3146411 3146417 - 10537212
MF098722 hybOABCDEFG operon
TACGTATT
3146435 3146442 - 10537212
MF098723 hybOABCDEFG operon
TGTGGTA
3146340 3146346 - 10537212
MF098725 dcuC operon
TACTACT
656521 656527 - 10368146
MF098797 focApflBA operon
TTTACTCCGTATTTGCATAAAAACCATGCGAGTTACGGGCCTATAAGC
954551 954598 - 7601827
MF098798 focApflBA operon
TTATTCGCCTGATGCTCCCTTTTAATTAACTGTTTTAGCGGAGGATGCGGAAAAAATTCAACTCATTTGTTAATT
954632 954706 - 7601827
MF098799 focApflBA operon
AAATAATTGTAATTATAAGGTTAAATATCGGTAATTTGTATTTAATAAATACGA
954721 954774 - 7601827
MF098800 focApflBA operon
CTTAATGATTAGTCTGA
954830 954846 - 7601827
MF099392 nuoABCEFGHIJKLMN operon
TGCTAAT
2405281 2405287 - 7565112
MF099393 napFDAGHBC operon
TACCCCGATCGGGGTA
2303611 2303626 - 13129959
MF099394 dcuB operon
TACAAAA
4348806 4348812 - 9852003
MF099395 dcuB operon
aggatta
4346339 4346345 + 9852003
MF099396 dcuB operon
CACACAT
4348743 4348749 - 9852003
MF099397 dcuB operon
TATCATA
4348718 4348724 - 9852003
MF099398 cydDC operon
TACCTCG
931108 931114 - 9335308
MF099810 ydhYVWXUT operon
TAACGAT
1754681 1754687 - 18227264
MF099811 ydhYVWXUT operon
TAATCAC
1754655 1754661 - 18227264
MF099812 ydhYVWXUT operon
TAACCAT
1754634 1754640 - 18227264
MF099813 ydhYVWXUT operon
AGGATTA
1754625 1754631 - 18227264
MF099874 yeaR-yoaG operon
TAACCA
1880040 1880045 - 17720788
MF099875 yeaR-yoaG operon
AAATGG
1880032 1880037 - 17720788
MF099876 yeaR-yoaG operon
GTATTT
1880027 1880032 - 17720788
MF099877 yeaR-yoaG operon
TTTAAA
1880024 1880029 - 17720788
MF099878 yeaR-yoaG operon
TACCCT
1880001 1880006 - 17720788
MF099880 ytfE operon
TGCTAC
4432057 4432062 - 17720788
MF099881 ytfE operon
AGGGTTA
4432047 4432053 - 17720788
MF099882 ytfE operon
TAAAAT
4432017 4432022 - 17720788
MF100460 focApflBA operon
7601827