Details for MX000006

General Information

MX000006

SpoIIID

BSU36420

Bacillus subtilis subsp. subtilis str. 168 chromosome, complete genome.

NCBI GenBank BacDive

Frequency Matrix

A 4 6 6 11 0 17 11 4 0 5
T 8 0 4 0 0 0 1 3 5 3
G 4 11 6 2 2 0 5 8 1 6
C 1 0 1 4 15 0 0 2 11 3
Consensus N R N M C A R N Y N

Sequence Logo

Motif List

Motif AccMotif NameBinding SequenceStartEndOrientationPubMed-ID
MF097615 spoIVCA operon
GACCGAGGAACAAGCGA
2654831 2654847 - 7966271
MF097616 spoIVCA operon
TTGGACAAACAGCT
2655002 2655015 - 7966271
MF097617 spoIVCB operon
CAGACACAGACAGCCTCCC
2652920 2652938 + 7966271
MF097618 spoIVCB operon
AGCTTGTCTTTT
2653036 2653047 + 7966271
MF097619 spoIVCB operon
CAATGCCTTTCCACAA
2653067 2653082 + 7966271
MF097620 bofA operon
ATAAGCTTGTACTAGAACAAGCG
29731 29753 + 7966271
MF097621 bofA operon
TTTTAGGACTGGTTATT
29800 29816 + 7966271
MF097622 cotD operon
NA
2332344 2332357 - 7966271
MF097623 cotD operon
NA
2332307 2332321 - 7966271
MF097624 cotD operon
NA
2332213 2332224 - 7966271
MF097625 spoVD operon
TTCTACCTGTCCA
1584153 1584165 + 9006059
MF097626 spoVD operon
AAAATGAAACAAGCCTA
1584177 1584193 + 9006059
MF097627 cotC operon
CATTTGGACAGCC
1905284 1905296 - 10788508
MF097628 cotC operon
TAACTGTCCAAGCC
1905250 1905263 - 10788508
MF097629 cotX operon
AGGCTCGCTC
1251209 1251218 - 10788508