Details for MX000007

General Information

MX000007

ArgR

PA0893

Pseudomonas aeruginosa PAO1 chromosome, complete genome.

NCBI GenBank BacDive

Frequency Matrix

A 1 0 1 0 0 0 7 5 4 4 4 2 4 3 13 14 4
T 14 0 13 1 1 1 1 6 4 4 3 6 0 6 0 1 4
G 1 16 2 1 16 1 8 4 2 5 2 4 12 1 3 2 7
C 1 1 1 15 0 15 1 2 7 4 8 5 1 7 1 0 2
Consensus T G T C G C R N N N N N R N A A N

Sequence Logo

Motif List

Motif AccMotif NameBinding SequenceStartEndOrientationPubMed-ID
MF098393 aruC operon
CGGGTTGGCGCTATAACAAGTTGTCGCATGGCGGCAATGCCG
977807 977848 + 9286981
MF098394 aruC operon
CTGCGCCTTCCCGATGCTTTCTGTCGCATTTCCGAAAGCCGC
977756 977797 + 9286981
MF098395 carA operon
CGTCGTCTTATTGGTGGACCGGAATGTCGCGATTCTGTAAACTAC
5345029 5345073 - 9286981
MF098396 argF operon
CCTCCTTGTGTTTCCGCGACATTTCCTTATAAGATCGCGCCT
3958883 3958924 + 9286981
MF098397 aot + argR operon
CTTCGGTGCTTTTATAATTAGTTGTCGCATTGAAGAAATAACC
971963 972005 + 9791103
MF098398 oprD operon
CGCACCTACGCAGATGCGACATGCGTCATGCAATTTTGCGACA
1045459 1045501 - 10464217
MF098399 arcDABC arginine deiminase pathway operon
GCGACTTACAGGAATGCGTCATCTAATTACTTTGAGTAGGAA
5820786 5820827 + 10198009
MF098452 gdhB operon
TGCTCCCGGGGTGAACGAATATGTCGCAGCACGGTAAGTGTTT
3441665 3441707 - 11133942
MF099643 argG operon
TGTCGCTTTTGCGTCTAAAGCTGTCGCCCCTCTGTAATTTCC
3945935 3945976 - 15175299
MF099644 gdhA operon
GAAAGTTTCAGTTTTGCACCATAAAGATTCATCAATGCGTCA
5138836 5138877 - 15175299
MF099645 braZ operon
CGGACTGTTCTGATTGCGACGTCGTTTTTCAACAAAAGGACA
2153249 2153290 - 15175299
MF099646 adcAB operon
CCGACTTGTGTTGCCGCGACCTTTTCTTACAAGGGCAAGCCG
1974699 1974740 + 15175299
MF099647 speA operon
CGGCACCGCGAGGCCGCGCCAGCCCTTTCCCTAGATGGGAGA
5433467 5433508 - 15175299
MF099648 PA0328 operon
GCCAGTTACAACGTAGCGACACCTCAGGTCGCCCAGGCGTCA
370501 370542 - 15175299
MF099649 ygjU operon
GGGATTTCCGGCCTCCCGGCTGGCAATGCGCCTGCGACGACA
2233779 2233820 + 15175299
MF099650 PA3934 operon
GGTCGCCTCTGCGACATTCGCTGTCGTGTCCCGGCGTGCCGC
4413076 4413117 - 15175299
MF099651 PA5152-PA5153 operon
CAGTTTTGTTCCTACGCGACAGCGCACTGCAGCGATGCGACA
5800369 5800410 + 15175299