Details for MX000008

General Information

MX000008

GlpR

b3423

Escherichia coli str. K-12 substr. MG1655, complete genome.

NCBI GenBank BacDive

Frequency Matrix

A 6 11 1 1 4 1 1 5 12 9 14 9 1 3 7 10 4 9 2 2
T 12 5 16 1 9 13 0 1 4 9 4 8 5 2 1 3 1 3 11 9
G 1 3 1 18 1 5 2 12 4 1 0 1 1 11 3 6 1 6 4 4
C 1 1 2 0 6 1 17 2 0 1 2 2 13 4 9 1 14 2 3 5
Consensus W N T G N K C R D W W W Y N N N M N N N

Sequence Logo

Motif List

Motif AccMotif NameBinding SequenceStartEndOrientationPubMed-ID
MF098061 glpD operon
TATGTTCGATAACGAACATT
3561961 3561980 + 3045087
MF098062 glpD operon
TATGAGCTTTAACGAAAGTG
3561981 3562000 + 3045087
MF098063 glpD operon
GGTTTGCGTTTTGGCGCAAA
3562376 3562395 + 3045087
MF098064 glpD operon
TAAGCGCGGATTCGAATATT
3562417 3562436 + 3045087
MF098066 glpFK operon
ATGGCGCGATAACGCTCATT
4118231 4118250 - 1372899
MF098067 glpFK operon
TATGACGAGGCACACACATT
4118210 4118229 - 1372899
MF098068 glpFK operon
TAAGTTCGATATTTCTCGTT
4118189 4118208 - 1372899
MF098069 glpFK operon
tttgctcgttaacgataagt
4115749 4115768 - 1372899
MF098072 glpFK operon
CGCGGTCGTAATGGATCACG
4117150 4117169 - 1372899
MF098073 glpFK operon
GCAGCGCGAATTTGAGCAAA
4117108 4117127 - 1372899
MF098074 glpACB operon
AATGGTAAAAAACGAACTTC
2352615 2352634 + 9179845
MF098075 glpACB operon
TATGCGCGAAATCAAACAAT
2352575 2352594 + 9179845
MF098076 glpACB operon
ACTTTCGAATTATGAGCGAA
2352555 2352574 + 9179845
MF098077 glpACB operon
AATGTTCAAAATGACGCATG
2352523 2352542 + 9179845
MF098080 glpTQ operon
TGTGTGCGGCAATTCACATT
2352483 2352502 - 1556120
MF098971 glpD operon
TATGTACGATCATCTGGGTA
3562330 3562349 + 8955388
MF098972 glpD operon
ACTGTTGGGTAGACGACGCC
3562440 3562459 + 8955388
MF098996 glpTQ operon
ATCGCTCGAATCCGCGCGTT
2352093 2352112 - 9179845
MF098997 glpTQ operon
TGGGTTCGGTATCGGATCGC
2352108 2352127 - 9179845
MF098998 glpTQ operon
GATTTTCGAAATTCATCATG
2352126 2352145 - 9179845