Details for MX000009

General Information

MX000009

ResD

BSU23120

Bacillus subtilis subsp. subtilis str. 168 chromosome, complete genome.

NCBI GenBank BacDive

Frequency Matrix

A 4 1 3 0 0 0 0 1 4 2 3 2 1 0 0 1 2 1 1 2 5
T 2 2 3 6 6 0 6 3 1 1 2 4 4 6 6 5 3 5 2 1 0
G 0 2 0 0 0 5 0 2 0 1 0 0 0 0 0 0 0 0 2 1 1
C 0 1 0 0 0 1 0 0 1 2 1 0 1 0 0 0 1 0 1 2 0
Consensus W N W T T G T K M N W W W T T T W T N N A

Sequence Logo

Motif List

Motif AccMotif NameBinding SequenceStartEndOrientationPubMed-ID
MF097605 ctaA operon
tttgtgaactttttatgaat
1558574 1558593 - 10972837
MF097606 ctaA operon
tttgtgaac
1558452 1558460 - 15375128
MF097607 ctaA operon
aaggtgaatattgtatgaat
1558354 1558373 - 15375128
MF097630 hmp operon
ATTGATAATTTTGTGACA
1372674 1372691 + 15375128
MF097631 nasD operon
ttcgtatattttgttaca
357832 357849 - 15375128
MF097632 fnr operon
attcacaagattgttagt
3831353 3831370 - 15375128
MF100153 yclJK operon
15375128