Details for MX000010

General Information

MX000010

IHF

PA2738, PA3161

Pseudomonas aeruginosa PAO1 chromosome, complete genome.

NCBI GenBank BacDive

Frequency Matrix

A 0 4 4 1 1 0 2 0
T 0 0 0 2 0 0 1 4
G 0 0 0 1 3 2 1 0
C 4 0 0 0 0 2 0 0
Consensus C A A D R S D T

Sequence Logo

Motif List

Motif AccMotif NameBinding SequenceStartEndOrientationPubMed-ID
MF098437 FleSR operon
GTTTCGCAACGCTTTGATTTTCAAATGAAAAAAA
1189066 1189099 + 9287015
MF098444 hemA operon
CAAGGGATTTGTTCA
5235043 5235057 - 12073043
MF098445 hemA operon
CAATACATCGGCAAT
5234918 5234932 - 12073043
MF098446 hemA operon
CAATGGTTGTCCTGC
5234907 5234921 - 12073043