Details for MX000011

General Information

MX000011

RhlR

PA3477

Pseudomonas aeruginosa PAO1 chromosome, complete genome.

NCBI GenBank BacDive

Frequency Matrix

A 0 0 1 0 2 3 1 4 2 0 0 1 0 2 4 0
T 0 6 0 2 0 2 1 1 3 1 4 1 1 2 0 0
G 0 0 4 0 2 1 3 1 0 0 1 4 4 0 2 4
C 6 0 1 4 2 0 1 0 1 5 1 0 1 2 0 2
Consensus C T R Y V W N R W C Y R S H R S

Sequence Logo

Motif List

Motif AccMotif NameBinding SequenceStartEndOrientationPubMed-ID
MF098420 AcpP-like operon
caCTgccagatctggcAGtt
2031377 2031396 + 11544214
MF098421 phzA1 operon
acCTaccagatcttgtAGtt
4713406 4713425 + 11544214
MF098423 rhlAB operon
tcCTgtgaaatctggcAGtt
3893269 3893288 - 10570171
MF098429 pa1L operon
TCCTGCATGAATTGGTAGGC
2905654 2905673 - 11053384
MF098430 migA operon
CTGTGTTTCCGACAGC
779305 779320 - 11021926
MF098431 migA operon
CTCCAGCGACCGTAGC
779335 779350 - 11021926