Details for MX000012

General Information

MX000012

LasR

PA1430

Pseudomonas aeruginosa PAO1 chromosome, complete genome.

NCBI GenBank BacDive

Frequency Matrix

A 0 0 7 1 1 6 1 8 0 0 3 2 2 3 12 1
T 3 10 2 5 0 5 4 6 12 3 8 1 0 7 2 1
G 0 2 3 3 0 2 6 0 0 1 2 11 6 0 0 12
C 11 2 2 5 13 1 3 0 2 10 1 0 6 4 0 0
Consensus C Y N N C N N W T Y N G S H A G

Sequence Logo

Motif List

Motif AccMotif NameBinding SequenceStartEndOrientationPubMed-ID
MF098386 hcnABC operon
ACCCCACCTACCAGAATTGGCAGGGG
2412430 2412455 + 15505212
MF098387 hcnABC operon
ACCGCGCGTTTCCACCAGGG
2412308 2412327 + 11544214
MF098418 lasB operon
ACCTGCTTTTCTGCTAGCTA
4170717 4170736 - 15505212
MF098419 lasB operon
acCTgccagttctggcAGgt
4170657 4170676 - 8576049
MF098420 AcpP-like operon
caCTgccagatctggcAGtt
2031377 2031396 + 11544214
MF098421 phzA1 operon
acCTaccagatcttgtAGtt
4713406 4713425 + 11544214
MF098422 lasI operon
atCTatctcatttgctAGtt
1559179 1559198 + 11544214
MF098424 rhlL operon
CCCTACCAGATCTGGCAGGT
3889880 3889899 - 12076794
MF098425 rsaL operon
AATTTTATAACTAGCAAAT
1559188 1559206 - 10094696
MF098427 RsaL operon
aactagcaaatgagatagat
1559179 1559198 - 11544214
MF098428 rhlR operon
TTTTGCCGTATCGGCAAGGC
3890722 3890741 - 9150205
MF099575 PA0572 operon
AAAACAACCAGAACAGATAGTTTTTCC
627921 627947 - 15505212
MF099576 PA3904 operon
CCTCCTGAGCAGTTCAGATAGGTTGT
4373858 4373883 + 15505212
MF099577 PA4677 operon
GCCGGCAACTAGCTATCACTTGGAGTAGCTGGCTGGCCTTCT
5247562 5247603 - 15505212