Details for MX000014

General Information

MX000014

OmpR

HP0166

Helicobacter pylori 26695 chromosome, complete genome.

NCBI

Frequency Matrix

A 2 2 2 0 0 1 2 0 0 1 0 0 1 2 1 0 2 0 0 0 2 0 0 1 2 2 0
T 0 0 0 0 0 0 0 2 0 0 2 2 1 0 0 1 0 1 1 0 0 2 2 0 0 0 2
G 0 0 0 0 1 0 0 0 0 1 0 0 0 0 0 0 0 1 0 2 0 0 0 1 0 0 0
C 0 0 0 2 1 1 0 0 2 0 0 0 0 0 1 1 0 0 1 0 0 0 0 0 0 0 0
Consensus A A A C S M A T C R T T W A M Y A K Y G A T T R A A T

Sequence Logo

Motif List

Motif AccMotif NameBinding SequenceStartEndOrientationPubMed-ID
MF098373 HP119 operon
AAACCAATCGTTTAATAGCGATTAAAT
130832 130858 - 11751811
MF100483 HP1408 operon
11751811