Details for MX000015

General Information

MX000015

MtrB

BSU22770

Bacillus subtilis subsp. subtilis str. 168 chromosome, complete genome.

NCBI GenBank BacDive

Frequency Matrix

A 0 9 6 8 9 8 7 2
T 1 0 2 1 0 1 0 4
G 0 0 0 0 0 0 1 2
C 8 0 1 0 0 0 1 0
Consensus C A W A A A A D

Sequence Logo

Motif List

Motif AccMotif NameBinding SequenceStartEndOrientationPubMed-ID
MF097838 yhaG operon
GAGCATATTATTGGAGGGCAAAAAGCTTAGCAGAGGAGAGCATAGTTATGAAAACAAAAGAGTTAG
1075146 1075211 - 10735881
MF097841 trpEDCFBA operon
TAGAATGAGTTGAGTTAGAGAATAGGGTAGCAGAGAATGAGTTTAGTTGAGCTGAG
2377529 2377584 - 11566991