Details for MX000016

General Information

MX000016

Fur

HP1027

Helicobacter pylori 26695 chromosome, complete genome.

NCBI

Frequency Matrix

A 1 2 0 1 2 1 1 1 1 1 1 1 0 0 2 2 1 1 3 2 3 3 0
T 2 1 3 1 0 1 1 1 1 0 2 2 3 3 1 0 2 0 0 1 0 0 3
G 0 0 0 1 0 1 0 0 1 1 0 0 0 0 0 0 0 1 0 0 0 0 0
C 0 0 0 0 1 0 1 1 0 1 0 0 0 0 0 1 0 1 0 0 0 0 0
Consensus W W T D M D H H D V W W T T W M W V A W A A T

Sequence Logo

Motif List

Motif AccMotif NameBinding SequenceStartEndOrientationPubMed-ID
MF098374 frpB operon
TTTTAATCTGGTTTTAATAATAATTATTATACTATTCTA
927291 927329 + 11466300
MF098375 FrpB operon
CTATTCGTAACAATTAATGAAAATAA
927241 927266 + 11466300
MF098376 ceuE operon
ATATTTTAGGATTTTGTGAAAAATAGTTTCATTT
1645047 1645080 - 11466300