Details for MX000017

General Information

MX000017

CtsR

BSU00830

Bacillus subtilis subsp. subtilis str. 168 chromosome, complete genome.

NCBI GenBank BacDive

Frequency Matrix

A 1 0 0 0 2 2 1 1 2 1 1 0 0 0 2 2 2
T 0 0 2 0 0 0 1 1 0 1 0 0 2 0 0 0 0
G 1 2 0 0 0 0 0 0 0 0 1 2 0 0 0 0 0
C 0 0 0 2 0 0 0 0 0 0 0 0 0 2 0 0 0
Consensus R G T C A A W W A W R G T C A A A

Sequence Logo

Motif List

Motif AccMotif NameBinding SequenceStartEndOrientationPubMed-ID
MF097633 clpC operon
AGTCAAATATAGTCAAAGTCAGT
101411 101433 + 9987115
MF097634 clpP operon
TTTGACCTTTATTGACC
3546165 3546181 + 9987115
MF097673 clpE operon
GGTCAAAgAtGATCAAA
1437749 1437765 - 10320580
MF097674 clpE operon
AGTCAAAgAaGGTCAAA
1437795 1437811 - 10320580
MF097675 clpE operon
GGTCAAAgAtAGTCAAA
1437870 1437886 - 10320580
MF097676 clpE operon
AATCAAAgTtGGTCAAA
1437914 1437930 - 10320580
MF097677 clpE operon
AGTCAAAgAtAGTCAGA
1437941 1437957 - 10320580