Details for MX000018

General Information

MX000018

CtsR

lmo0229

Listeria monocytogenes EGD-e chromosome, complete genome.

NCBI

Frequency Matrix

A 2 0 0 0 4 4 4 2 2 2 2 0 0 0 4 3 3 1
T 0 0 4 0 0 0 0 0 2 2 0 0 4 0 0 0 1 0
G 2 4 0 0 0 0 0 1 0 0 2 4 0 0 0 1 0 2
C 0 0 0 4 0 0 0 1 0 0 0 0 0 4 0 0 0 1
Consensus R G T C A A A V W W R G T C A R W V

Sequence Logo

Motif List

Motif AccMotif NameBinding SequenceStartEndOrientationPubMed-ID
MF097599 clpC operon
AGTCAAAAATAGTCAAAGTCAAT
248499 248521 + 10692157
MF097600 clpP operon
GTTTGACCTAGTTTGACC
2541935 2541952 + 10692157
MF097601 clpE operon
AGTCAAAATAGGTCAGTA
1029123 1029140 - 10692157
MF097602 clpE operon
GGTCAAAGATAGTCAAAG
1029089 1029106 - 10692157