Details for MX000020

General Information

MX000020

AraR

BSU33970

Bacillus subtilis subsp. subtilis str. 168 chromosome, complete genome.

NCBI GenBank BacDive

Frequency Matrix

A 4 1 0 1 0 0 4 0 0 1 5 0 2 2 3 0
T 1 4 5 4 0 5 0 0 0 4 0 2 2 2 2 5
G 0 0 0 0 5 0 0 0 5 0 0 0 0 0 0 0
C 0 0 0 0 0 0 1 5 0 0 0 3 1 1 0 0
Consensus A T T T G T A C G T A Y H H W T

Sequence Logo

Motif List

Motif AccMotif NameBinding SequenceStartEndOrientationPubMed-ID
MF097588 araA operon
ATTAGTACGTATCTTT
2948919 2948934 - 10417639
MF097644 araA operon
aattgttcgtacaaatat
2948070 2948086 - 10417639
MF097645 araE operon
ATATTTGTACGTACTAATTA
3485556 3485575 - 10417639
MF097646 araR operon
AAATTTGTCCGTATACATTTT
3485637 3485657 + 10417639
MF097647 araE operon
TTAATATAAGTACGTACAATT
3485515 3485535 - 10417639