Details for MX000026

General Information

MX000026

TnrA

BSU13310

Bacillus subtilis subsp. subtilis str. 168 chromosome, complete genome.

NCBI GenBank BacDive

Frequency Matrix

A 0 1 2 3 13 2 9 7 9 9 3 7 0 5 13 0 11
T 12 0 9 5 1 1 2 6 5 5 9 1 13 3 0 0 1
G 0 12 2 2 0 6 2 0 0 0 2 1 0 4 0 0 0
C 1 0 0 3 0 5 1 1 0 0 0 4 0 1 0 13 1
Consensus T G W N A N N W W W W M T N A C A

Sequence Logo

Motif List

Motif AccMotif NameBinding SequenceStartEndOrientationPubMed-ID
MF097755 ykzB operon
CGGAAGAAAAATTAACA
1397851 1397867 + 10671441
MF097756 tnrA operon
TGTTAGAAAATATGACA
1397808 1397824 - 16547045
MF097791 nasD operon
TGTTACATTTTATAACA
358250 358266 - 9765565
MF097792 gltAB operon
TGTTAGATTTTATGACC
2014667 2014683 - 11029411
MF097793 ureABC operon
TGTAAACTTTTATAACA
3769925 3769941 - 9287005
MF097795 ureABC operon
TGTGAATAAATATAACA
3770030 3770046 - 9287005
MF097798 nrgAB operon
TGTCAGGAAATCTTACA
3756688 3756704 + 9603886
MF097799 gabP operon
TGGTATATTTTCTTACA
686651 686667 - 8951816
MF097800 nasA operon
TGTCACAAAAACTTACA
362839 362855 + 9603886
MF097801 nasBC operon
TGTAAGTTTTTGTGACA
362839 362855 - 9603886
MF097802 gabP operon
TATTACGCAAAATCACA
686745 686761 - 8951816
MF097804 glnRA operon
TGACACATAATATAACA
1877900 1877916 + 8799114
MF097823 ansZ operon
TACTGAGAGAAAAGCTGACTGATC
290828 290851 + 11914346
MF099683 tnrA operon
NA
1397317 1397333 - 16547045