Details for MX000029

General Information

MX000029

Fis

b3261

Escherichia coli str. K-12 substr. MG1655, complete genome.

NCBI GenBank BacDive

Frequency Matrix

A 6 36 35 12 87 75 67 70 56 52 20 46 53 41 8
T 12 32 54 49 12 31 34 47 46 52 75 15 19 23 4
G 112 32 21 28 25 14 18 14 15 20 11 38 37 31 8
C 4 34 24 45 10 14 15 3 17 10 28 35 25 39 114
Consensus G N N N R N N W N N N N N N C

Sequence Logo

Motif List

Motif AccMotif NameBinding SequenceStartEndOrientationPubMed-ID
MF098169 nirBD operon
GAGGCAAAAATGAGC
3494002 3494016 + 10972841
MF098170 nirBD operon
GTCTATTTTTTGCAC
3493838 3493852 + 10972841
MF098175 acs + nrfABCDEFG operon
GGTTATTTGTTACACA
4287649 4287664 +/- 11929525
MF098189 fis operon
CAGTATGGTCATTTCTTAACTCATGCG
3410258 3410284 + 9335285
MF098190 fis operon
GGATTGGTCAAAGTTTGGCCTTTCATCTCGTGCA
3410192 3410225 + 9335285
MF098191 fis operon
TATGAGTAATTATCGCACCACGCTCATTTTAAATGCAATT
3410135 3410174 + 9335285
MF098192 fis operon
TTGAGTGTAAATTTTAGTCACT
3410092 3410113 + 9335285
MF098193 fis operon
TTTGCCGATTATTTACGCAAATT
3410015 3410037 + 9335285
MF098196 nuoABCEFGHIJKLMN operon
aaatttgttgctgcgtttttgtta
2403483 2403506 - 10628873
MF098197 nuoABCEFGHIJKLMN operon
tcccgaacgcacaaataatcgcctgaaaaaaatc
2403536 2403569 - 10628873
MF098198 nuoABCEFGHIJKLMN operon
aaatttgttgctgcgtttttgtta
2403483 2403506 - 10628873
MF098267 proP operon
ATGTGTGAAGTTGATCACAAATT
4330275 4330297 + 10894725
MF098268 proP operon
ATTGTACATTCCTTAACCGGA
4330356 4330376 + 10894725
MF098269 proP operon
AAAGGTCATTAACTGCCCAAT
4330316 4330336 + 10894725
MF098271 bglGFB operon
ggtcatatttttatc
3904371 3904385 - 10760165
MF098272 bglGFB operon
tgctattttctctgc
3904346 3904360 - 10760165
MF098274 nrdAB operon
TATTATGCCGTTCAAGAAATCGCCGAACAG
2344583 2344612 + 9680219
MF098275 nrdAB operon
AAAGATTAATAAGCCATCTAT
2344546 2344566 + 9396807
MF098276 nrdAB operon
ATTGACCACAACTGATACATC
2344476 2344496 + 9396807
MF098277 nrdAB operon
ACCGAATAGAAAACAACCATT
2344422 2344442 + 9396807
MF098278 fis operon
TATGAGTAATTATCGCACCAC
3410135 3410155 + 9396807
MF098279 adhE operon
ttgtgcaaaacatgc
1297671 1297685 - 10572146
MF098280 adhE operon
tgctatcattcgtta
1297697 1297711 - 10572146
MF098281 adhE operon
gttagccataaataa
1297777 1297791 - 10572146
MF098282 hns operon
taagtttgagattactacaat
1292144 1292164 - 9396807
MF098283 hns operon
tacctcaacaaaccaccccaa
1292167 1292187 - 9396807
MF098284 hns operon
aaagaacaattttgaattcct
1292231 1292251 - 9396807
MF098285 hns operon
ctggctaattttatgaaaaga
1292273 1292293 - 9396807
MF098286 hns operon
aatcaggaagttttaacctca
1292342 1292362 - 9396807
MF098287 hns operon
gaagactgaaaggtcgtcagc
1292394 1292414 - 9396807
MF098288 hns operon
actgttctacttttcatcatt
1292452 1292472 - 9396807
MF098289 ndh operon
AGAGCTATGTTAATAACCATT
1166028 1166048 + 9396807
MF098290 ndh operon
GTCGCCTATCTTTTCAGCAAC
1165909 1165929 + 9396807
MF098291 ndh operon
TTCGCTCAAATAATAAACAAT
1165858 1165878 + 9396807
MF098292 queA + tgt + yajC + secDF operon
TGAGCTAAAAAATTCATCGAT
424902 424922 + 1508713
MF098293 queA + tgt + yajC + secDF operon
NA
424121 424141 + 1508713
MF098294 tufB operon
GATGTTGAAAAAGTGTGCTAA
4175248 4175268 + 1380692
MF098295 tufB operon
TTCGGCTGTTTCTTCATCGTG
4175280 4175300 + 9396807
MF098296 tufB operon
GTCGCATAAAATGTGACCAAT
4175300 4175320 + 1380692
MF098297 nrdAB operon
TTTTAACAAATTTTTCTCTTC
2344617 2344637 + 9396807
MF098298 aldB operon
tggcgaagatttcgcc
3754186 3754201 - 7768815
MF098299 aldB operon
gtcgtaaagctgtta
3754208 3754222 - 7768815
MF098300 aldB operon
ggcaaattgttagcc
3754271 3754285 - 7768815
MF098301 aldB operon
gtaatcatcatttcc
3754295 3754309 - 7768815
MF098302 aldB operon
ggcgatttatcgcgc
3754313 3754327 - 7768815
MF098309 acnB operon
GATTAACACCTCGTC
131482 131496 + 9421904
MF098310 acnB operon
CCTTAACGATTCAGC
131438 131452 + 9421904
MF098311 acnB operon
GTTTAAATTTTGACT
131341 131355 + 9421904
MF098319 marRAB operon
GAACAAAACTTGAAC
1619005 1619019 + 9393706
MF098320 dnaAN + recF operon
agaaacagaagatctcttgcgcagtttag
3881523 3881551 - 8830699
MF098326 ptsG operon
ACTCTGTGTAATAAATAAAGGGCGCTTA
1157756 1157783 + 12588863
MF098327 ptsG operon
CAAATTGGCACTGAATTATTTT
1157734 1157755 + 12588863
MF098328 ptsG operon
GTTTTGTCAAAATGTGCAACTTCTCCAAT
1157674 1157702 + 12588863
MF098329 ptsG operon
GGGCGGTGAATAACCACGTTTGAAAT
1157636 1157661 + 12588863
MF098330 ptsG operon
TAAAACGAGTAAAGTTCACC
1157606 1157625 + 12588863
MF098331 osmE operon
ggacggaatatgaac
1820275 1820289 - 12395194
MF098332 osmE operon
gcttgaaaaagcgcc
1820330 1820344 - 12395194
MF098333 osmE operon
ggtggttaaaacgtc
1820385 1820399 - 12395194
MF098337 crp operon
GTACAGTTGATAGCCC
3486013 3486028 + 9582281
MF098338 crp operon
GGACGTCACATTACC
3485993 3486007 + 9582281
MF098339 crp operon
GTACTGCATGTATGCA
3485975 3485990 + 9582281
MF098340 crp operon
GTACGCGTACTAACCA
3485854 3485869 + 9582281
MF098341 topA operon
CTGAATTTTCGTGAACAGAGTCACGA
1330912 1330937 + 10760142
MF098342 topA operon
TATAGCGCCTGTAGGCCAAGACCTGTTAA
1330874 1330902 + 10760142
MF098343 topA operon
ATTTGCTTGACATTCGACCA
1330840 1330859 + 10760142
MF098344 gltX + valUXY operon
gtcgtaaatttaagc
2518864 2518878 +/- 9570400
MF098345 gltX + valUXY operon
gatcgcaaaacagac
2518844 2518858 +/- 9570400
MF098346 gltX + valUXY operon
gcgcaatttgtcaac
2518823 2518837 +/- 9570400
MF098347 pdhX + tyrS operon
ttttcgcgtcagcctt
1715477 1715492 - 1356963
MF098348 pdxHtyrS operon
gtttcaacagggcga
1715520 1715534 - 1356963
MF098349 guaBA operon
GATAGTAACCCGCCC
2634177 2634191 - 8828209
MF098350 guaBA operon
GCAGGTTATTCAGTC
2634192 2634206 - 8828209
MF098356 hupA operon
TATTGGTATAATTTTTCAGCAATAAG
4200070 4200095 + 8913296
MF098357 hupA operon
TTAGCTGAGTGCGAAGAACGCGATATCGAGCT
4199993 4200024 + 8913296
MF098358 hupA operon
AGAAAACCCAGCTGTAGAGCAAGAATGGGACATTCAGT
4199938 4199975 + 8913296
MF098359 hupA operon
TGGTCGCGAAATGAGCGATGAAGAGCTT
4199908 4199935 + 8913296
MF098361 hupB operon
GGTTGTGACTGCAAAATAGTGACCTCGCGCAAAATGCA
461224 461261 + 8913296
MF098362 hupB operon
CATTGAGGAAGTTCTGACTCTGGC
461173 461196 + 8913296
MF098363 hupB operon
GCTGCAAAATGAACCGTCTGGTA
461197 461219 + 8913296
MF098822 polA operon
GGATTTATTTTTAAC
4046737 4046751 + 9106210
MF098823 polA operon
TAATAAATTAAAAGC
4046795 4046809 + 9106210
MF099411 ygjG operon
CGACAAAAACCGTGCAAAATAACAACA
3219324 3219350 + 12617754
MF100147 rrnA operon
11591675
MF100172 rrnH operon
11591675
MF100195 leuV operon
10368169
MF100206 tyrT operon
9396807
MF100222 pUC19 oriE
9396807
MF100241 tyrT operon
9396807
MF100257 rrnH operon
11591675
MF100297 oriC
10692160
MF100313 rrnA operon
11591675
MF100358 rrnG operon
11591675
MF100361 rrnE operon
11591675
MF100404 rrnD operon
11591675
MF100421 rrnB operon
11591675
MF100455 rrnB operon
11591675
MF100459 rrnG operon
11591675
MF100464 rrnA operon
11591675
MF100468 rrnC operon
11591675
MF100477 rrnE operon
11591675
MF100481 rrnG operon
11591675
MF100482 rrnE operon
11591675
MF100497 rrnD operon
11591675
MF100522 rrnA operon
11591675
MF100526 rrnE operon
11591675
MF100534 rrnD operon
11591675
MF100539 rrnD operon
11591675
MF100555 tyrT operon
9396807
MF100571 oriC
9396807
MF100573 rrnC operon
11591675
MF100596 rrnC operon
11591675
MF100606 rrnH operon
11591675
MF100631 rrnE operon
11591675
MF100643 rrnH operon
11591675
MF100645 rrnD operon
11591675
MF100667 rrnB operon
11591675