Details for MX000030

General Information

MX000030

DegU (N10)

BSU35490

Bacillus subtilis subsp. subtilis str. 168 chromosome, complete genome.

14 compiled genomic DNA-binding sites; confidence level 4

NCBI GenBank BacDive

Frequency Matrix

A 3 0 3 1 1 1 1 0 1 3 1 0 0 1 0 0 0 2 0
T 0 0 0 1 1 2 1 1 1 0 0 2 2 0 3 3 1 0 0
G 0 3 0 1 0 0 1 0 0 0 2 0 0 0 0 0 0 1 3
C 0 0 0 0 1 0 0 2 1 0 0 1 1 2 0 0 2 0 0
Consensus A G A D H W D Y H A R Y Y M T T Y R G

Sequence Logo

Motif List

Motif AccMotif NameBinding SequenceStartEndOrientationPubMed-ID
MF097727 sacB operon
AGATAGATTTTTTAGTTCTTTAGGCC
3535695 3535720 + 9537385
MF097730 degSU operon
NA
3644545 3644570 - 9537385
MF097731 degR operon
ATCGAGAGCTGCCAGCTCTTCAGATT
2308664 2308689 - 9537385