Details for MX000031

General Information

MX000031

PhoP

b1130

Escherichia coli str. K-12 substr. MG1655, complete genome.

7 compiled genomic binding sites; contains two direct repeats separated by a spacer of 5 nucleotides

NCBI GenBank BacDive

Frequency Matrix

A 0 1 0 0 0 8 0 2 2 2 1 0 1 0 0 0 8
T 5 0 7 8 8 0 4 1 2 5 5 4 0 8 8 6 0
G 3 7 1 0 0 0 4 3 3 1 0 4 7 0 0 2 0
C 0 0 0 0 0 0 0 2 1 0 2 0 0 0 0 0 0
Consensus K G T T T A K N N W Y K G T T K A

Sequence Logo

Motif List

Motif AccMotif NameBinding SequenceStartEndOrientationPubMed-ID
MF098365 phoPQ operon
tcccctccccgctGGTTTAtttaaTGTTTA
1190508 1190537 - 12813061
MF098366 mgtA operon
GGTTTAtcgttGGTTTAgttgtcagcagg
4467321 4467349 + 12813061
MF098367 mgrB operon
tagttaggcgctgtttaactaacgcatg
1906830 1906857 - 12813061
MF098368 rstAB operon
tgaaaactTGTTTAgaaacGATTGAt
1682078 1682103 + 12813061
MF098369 slyB operon
gtttTGTTTAtaattGGTTGAtcctactttc
1719732 1719762 + 12813061
MF098370 yrbL operon
gaggcatTGTTTAggtttTGTTTA
3348378 3348401 + 12813061
MF098371 vboR operon
ctcattgtttagggtttgtttaattttc
578163 578190 - 12813061
MF099440 treR operon
CTAAACCAACGATAAACC
4467321 4467338 - 12123454