Details for MX000032

General Information

MX000032

PvdS

PA2426

Pseudomonas aeruginosa PAO1 chromosome, complete genome.

NCBI GenBank BacDive

Frequency Matrix

A 2 4 0 23 24 22 3 6 2
T 1 6 23 0 0 3 19 9 10
G 15 8 1 2 1 0 1 3 6
C 7 7 1 0 0 0 2 7 7
Consensus S N T A A A T N N

Sequence Logo

Motif List

Motif AccMotif NameBinding SequenceStartEndOrientationPubMed-ID
MF098575 pvdD operon
GCTAAATCC
2665210 2665218 - 11222621
MF098576 pvdE operon
GCTAAATAC
2653221 2653229 + 11222621
MF098577 pvdF operon
CGTAAATTG
2653184 2653192 - 11222621
MF098578 toxA operon
CATAAATCC
1242642 1242650 - 11222621
MF098579 ptxR operon
TCATTTATCGGAAAACGAAGGTGGCG
2487461 2487486 - 18227247
MF098580 toxR operon
GCTAGATAC
781042 781050 - 12368452
MF098581 pvdA operon
CTTAAATTT
2640359 2640367 - 11222621
MF098582 PA2411-PA2412 operon
GCTAATTTT
2694838 2694846 - 12207696
MF098583 PA2413 operon
AGTAAATCC
2696358 2696366 - 12207696
MF098584 PA2427 operon
GGTAAATTC
2723270 2723278 - 12207696
MF098585 PA2451-PA2452 operon
GGCAAATTT
2754513 2754521 - 12207696
MF098586 PA2393-PA2395 operon
GCTAAATTT
2648526 2648534 + 12207696
MF098587 fpvA operon
GGTAAAACG
2655109 2655117 + 12207696
MF098588 PA2424-PcdG operon
GCTAATTAT
2721681 2721689 - 12207696
MF098589 PA2400-PA2402 operon
GTTAATTTT
2687251 2687259 - 12207696
MF098590 PA2389-PA2391 operon
GTTAAATTT
2642037 2642045 + 12207696
MF098591 PA2531 operon
CATAAACGG
2858403 2858411 + 12207696
MF098592 PA5150 operon
GCGAAAGAT
5799505 5799513 - 12207696
MF098593 PA1134 operon
CTTAAACCG
1226351 1226359 - 12207696
MF098594 piv operon
TATAAAAAA
4671221 4671229 + 12207696
MF098595 PA0346 operon
CGTGAATCG
389174 389182 + 12207696
MF098596 PA0818 operon
CTTGAATGG
895741 895749 - 12207696
MF098597 PA4833 operon
ATTAAAACC
5423943 5423951 + 12207696
MF098598 mvfR operon
GGTAAATAT
1087459 1087467 - 12207696
MF100321 PA2392 operon
12207696