Details for MX000034

General Information

MX000034

AlgU (32-mer)

PA0762

Pseudomonas aeruginosa PAO1 chromosome, complete genome.

GAACT--17bp--TCcaA

NCBI GenBank BacDive

Frequency Matrix

A 2 1 0 8 9 0 0 0 1 2 1 1 1 0 2 3 3 4 3 4 2 3 2 2 2 0 0 2 4 9 1 2
T 3 1 0 0 0 0 9 9 4 2 0 2 2 0 0 2 1 0 2 1 2 1 3 0 3 9 0 2 1 0 4 0
G 1 5 9 0 0 0 0 0 2 3 2 4 4 6 2 3 3 3 2 2 3 2 4 4 2 0 0 1 0 0 2 3
C 3 2 0 1 0 9 0 0 2 2 6 2 2 3 5 1 2 2 2 2 2 3 0 3 2 0 9 4 4 0 2 4
Consensus N N G A A C T T N N S N N S V N N V N N N N D V N T C N M A N V

Sequence Logo

Motif List

Motif AccMotif NameBinding SequenceStartEndOrientationPubMed-ID
MF098599 oprF operon
AAGAACTTTGAGGGCAAGTCGAAGTTCAAAACGTGG
1920703 1920738 + 11807066
MF098600 lptA operon
TGGAACTTCACGCCAGCGCAAATGTTCAAAGGGCT
1735097 1735131 - 11807066
MF098601 PA0856 operon
TCGAACTTAGGCGCAGAATGTCGGGTCCCACGGACA
935410 935445 + 11807066
MF098604 osmC operon
CTGAACTTGTCCGGCTGCGTCGTCCTCCCATGTAGA
73407 73442 + 11807066
MF098605 PA3952 operon
AGGAACTTGAGATCGTGCAGGGTGCTCCAATATTTC
4433361 4433396 - 11807066
MF098608 algD-algA operon
CGGAACTTCCCTCGCAGAGAAAACATCCTATCACCG
3962423 3962458 + 11807066
MF098610 betT2 operon
TGGAACTTTCCTTGCGCGCCTTGCATCGCATACTCAAG
5954922 5954959 + 11807066
MF098611 PA4723 operon
CCGAACTTTGCGAGGAAAAACCGATTCTAACCAAGCCA
5302201 5302238 + 11807066
MF098615 algR operon
GGGCACTTTTCGGGCCTAAAGCGAGTCTCAGCGTCG
5923363 5923398 - 11807066