Details for MX000037

General Information

MX000037

RpoE-SigE

STY2833

Escherichia coli str. K-12 substr. MG1655, complete genome.

Salmonella enterica subsp. enterica serovar Typhi str. CT18, complete genome.

RpoE-SigE der Enterobacteriaceae

NCBI

Frequency Matrix

A 1 0 0 6 5 0 0 0 1 4 0 1 3 2 6 2 5 4 5 2 3 0 4 3 0 1 0 3 6 1 1
T 1 2 0 0 0 0 6 6 2 1 0 1 1 3 0 3 0 1 1 1 1 0 0 0 6 0 6 0 0 2 1
G 0 4 6 0 0 0 0 0 1 1 2 4 1 0 0 0 0 1 0 2 1 2 1 1 0 0 0 3 0 0 2
C 4 0 0 0 1 6 0 0 2 0 4 0 1 1 0 1 1 0 0 1 1 4 1 2 0 5 0 0 0 3 2
Consensus M K G A A C T T N R S R N W A W A R A N N S M M T C T R A Y N

Sequence Logo

Motif List

Motif AccMotif NameBinding SequenceStartEndOrientationPubMed-ID
MF098616 rpoH operon
TTGAACTTGTGGATAAAATCACGGTCTGATAAAACA
3600870 3600905 - 11807066
MF098617 htrA operon
CGGAACTTCAGGCTATAAAACGAATCTGAAGAACA
180810 180844 + 11807066
MF098618 rpoE operon
CGGAACTTTACAAAAACGAGACACTCTAACCCTTTG
2710088 2710123 - 11807066
MF098619 sigE operon
CGGAACTTTACGAAACATAGACACTCTAACCTGTTG
2695682 2695717 - 11807066
MF098620 htrA operon
CGGAACTTCGCGTTATAAAATGAATCTGACGTACAC
241426 241461 + 11807066
MF098621 slyB operon
ATGACCTTAACTGCATAAATGCCATATAATTTAGCTA
1605814 1605850 + 11807066