Details for MX000038

General Information

MX000038

CovR (11-mer)

MGAS10270_Spy0279

Streptococcus pyogenes MGAS8232 chromosome, complete genome.

NCBI

Frequency Matrix

A 1 1 2 2 5 0 0 4 4 5 4
T 3 3 1 2 0 5 5 0 0 0 0
G 1 1 0 0 0 0 0 1 1 0 1
C 0 0 2 1 0 0 0 0 0 0 0
Consensus D D H H A T T A A A A

Sequence Logo

Motif List

Motif AccMotif NameBinding SequenceStartEndOrientationPubMed-ID
MF098622 hasABC operon
CCTATTTTTAAAAAAACTTTAATTGTT
1875190 1875216 + 11918804
MF098623 hasABC operon
TCAAGGAAATTAAAAAAG
1875155 1875172 + 11918804
MF098624 hasABC operon
CCCTTATTTATATTAGAATATTG
1875120 1875142 + 11918804
MF098625 hasABC operon
CAATTTTATTGAAAATAT
1875080 1875097 + 11918804
MF098626 hasABC operon
TTTTAATGGAAGCA
1875066 1875079 + 11918804