Details for MX000039

General Information

MX000039

RofA

Spy_0124

Streptococcus pyogenes SF370 chromosome, complete genome.

NCBI

Frequency Matrix

A 0 0 0 0 0 1 1 1 2 3 3 3 2 0 1 2 0
T 3 3 3 3 2 1 0 0 0 0 0 0 1 2 0 0 3
G 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0
C 0 0 0 0 1 1 2 2 1 0 0 0 0 1 2 0 0
Consensus T T T T Y H M M M A A A W Y M R T

Sequence Logo

Motif List

Motif AccMotif NameBinding SequenceStartEndOrientationPubMed-ID
MF098637 rofA operon
TTTTTACCAAAAACCAT
116635 116651 - 9324268
MF098638 rofA operon and prtf operon
TTTTCTCAAAAAATCATTTTCAAAAACACTAATTTGGTGAAAAA
116685 116728 + 9324268