Details for MX000041

General Information

MX000041

CovR (16-mer)

MGAS10270_Spy0279

Streptococcus pyogenes MGAS8232 chromosome, complete genome.

NCBI

Frequency Matrix

A 0 1 4 0 0 1 0 0 3 5 3 4 5 4 4 2
T 3 3 1 5 4 4 5 5 2 0 1 1 0 1 0 0
G 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
C 1 1 0 0 1 0 0 0 0 0 1 0 0 0 1 3
Consensus B H A T T T T T W A H A A A A M

Sequence Logo

Motif List

Motif AccMotif NameBinding SequenceStartEndOrientationPubMed-ID
MF098642 speB operon
agaaactcatcaacattgacattcaagttgtctaagatataaagtaactttttcgaagaaatgtcaagattatttttaataaaacgata
1756341 1756429 - 11401704
MF098643 sagA operon
GATAATATTAAAAAGAAAGGGTTTACATATTAATCATTTTTTACTATAATAAAAGTGATAAGAACT
638035 638100 + 11401704
MF098644 hasABC operon
TTGACATTACCCCTTATTTATATTAGAATATTGAGGTCCTGTCTTTCAAGGAAATTAAAAAAGAAAGAGGTGTAATTGTGCCTATTTTTAAAAAAACTTTAATTGTTTTATCCTTT
1875110 1875225 + 11401704
MF098645 SpyM18_2042 operon
AATAGGTATTTTTTCTCTTTTTTCATTATCATGACATTATCATTAAGGTATCATTTAAAAACAATTATTAGGTTTTTGTTTGTATCTATAAAATTATTATGTTATTCTAATAATGGGGATTGAAACTTAAC
1703192 1703322 + 11401704
MF100150 new site
11401704