Details for MX000044

General Information

MX000044

CitT

BSU07590

Bacillus subtilis subsp. subtilis str. 168 chromosome, complete genome.

NCBI GenBank BacDive

Frequency Matrix

A 0 1 2 1 1 1 1 2 2 0 1 2 2 2 0 0 0 0 0 0 0 1 2 1 2
T 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 2 2 2 2 1 0 0 0
G 1 0 0 1 1 1 1 0 0 0 1 0 0 0 0 2 2 0 0 0 0 0 0 1 0
C 1 1 0 0 0 0 0 0 0 2 0 0 0 0 2 0 0 0 0 0 0 0 0 0 0
Consensus S M A R R R R A A C R A A A C G G T T T T W A R A

Sequence Logo

Motif List

Motif AccMotif NameBinding SequenceStartEndOrientationPubMed-ID
MF097723 citMyflN operon
CAGCAGGGAAACGAAACGGTTTTTAGA
834118 834144 + 10972810
MF097724 citMyflN operon
CAAAAAGAACAAAACGGTTTTAAAAAATTAAAAATACAAAAAAACCAA
834229 834276 + 12471443