Details for MX000045

General Information

MX000045

CodY

BSU16170

Bacillus subtilis subsp. subtilis str. 168 chromosome, complete genome.

NCBI GenBank BacDive

Frequency Matrix

A 1 0 0 0 0 0 0 0 1 0 0 0 2 2 2 1 0 0 2 1 1 0 0 0 1 0 1 1 1 0 2 1 1 2 1 1 1 2 1 1 1 0 1 2 2 2 1 0 2 1 0 0 1 1 0 2 2 1 0 2 0 1 0 1 1
T 1 2 1 2 1 2 2 1 1 2 1 2 0 0 0 0 1 0 0 0 0 0 0 2 1 1 1 1 1 1 0 1 0 0 1 1 1 0 1 0 1 2 0 0 0 0 1 0 0 1 1 1 1 1 2 0 0 1 1 0 1 0 1 1 1
G 0 0 0 0 1 0 0 0 0 0 1 0 0 0 0 0 0 2 0 0 0 2 2 0 0 1 0 0 0 1 0 0 0 0 0 0 0 0 0 1 0 0 1 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 1 0 1 0 0 0 0
C 0 0 1 0 0 0 0 1 0 0 0 0 0 0 0 1 1 0 0 1 1 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 2 0 0 1 0 0 0 0 0 0 0 0 0 0 1 1 0 0
Consensus W T Y T K T T Y W T K T A A A M Y G A M M G G T W K W W W K A W M A W W W A W R W T R A A A W C A W Y K W W T A A W K A K M Y W W

Sequence Logo

Motif List

Motif AccMotif NameBinding SequenceStartEndOrientationPubMed-ID
MF097834 comK operon
AAATATCATTAAAAGATGATTTTATCTTAAATGTTAAAAAAACCTGTCGTTTTACAAAAACAGAT
1116996 1117060 + 8830686
MF097835 srfAA operon
CGGTGATAAAAACATTTTTTTCATTTAAACTGAACGGTAGAAAGATAAAAAATATTGAAAACAATGAATAAATAGCCAAAATTGGTT
376640 376726 + 8830686