Details for MX000046

General Information

MX000046

ComA

BSU31680

Bacillus subtilis subsp. subtilis str. 168 chromosome, complete genome.

NCBI GenBank BacDive

Frequency Matrix

A 0 0 0 0 0 0 0 3 0 0 2 0 0 0 4 2 1 4 3 3
T 4 4 2 0 0 0 1 0 3 0 0 0 0 0 0 1 1 0 0 1
G 0 0 2 0 4 4 1 1 1 0 0 0 4 0 0 1 2 0 0 0
C 0 0 0 4 0 0 2 0 0 4 2 4 0 4 0 0 0 0 1 0
Consensus T T K C G G B R K C M C G C A D D A M W

Sequence Logo

Motif List

Motif AccMotif NameBinding SequenceStartEndOrientationPubMed-ID
MF097787 rapCphrC operon
TTTATTGCGTGCTCCCGAAA
428723 428742 + 10464187