Details for MX000048

General Information

MX000048

GltC

BSU18460

Bacillus subtilis subsp. subtilis str. 168 chromosome, complete genome.

NCBI GenBank BacDive

Frequency Matrix

A 4 0 0 0 2 5 4 2 2 2 0 5 0 5 0
T 1 5 1 5 0 0 1 3 3 2 2 0 3 0 5
G 0 0 0 0 0 0 0 0 0 0 3 0 2 0 0
C 0 0 4 0 3 0 0 0 0 1 0 0 0 0 0
Consensus A T C T M A A W W H K A K A T

Sequence Logo

Motif List

Motif AccMotif NameBinding SequenceStartEndOrientationPubMed-ID
MF097668 gltC operon
ATCTCAaaaTGAGAT
2014745 2014759 + 17134717
MF097669 gltC operon
ATATATaatTTAGAT
2014723 2014737 + 17134717
MF097670 gltAB operon
atctcattttgagat
2014001 2014015 + 7559359
MF097671 gltAB operon
ATCTAAattATATAT
2014723 2014737 - 7559359
MF097672 gltAB operon
ATATCGtttTGAAAA
2014703 2014717 - 7559359
MF099689 yrrT operon
taatccatagtatacttataggaatt
2787781 2787806 - 17056751