Details for MX000050

General Information

MX000050

Hpr

BSU09990

Bacillus subtilis subsp. subtilis str. 168 chromosome, complete genome.

NCBI GenBank BacDive

Frequency Matrix

A 3 3 3 2 3 0 7 1 2 5 2 3 3 2 8 1 3 3 3
T 3 4 3 4 2 7 1 7 4 2 5 2 0 5 0 4 3 5 3
G 1 1 0 2 2 0 0 0 0 1 1 3 2 0 0 1 0 0 0
C 1 0 2 0 1 1 0 0 2 0 0 0 3 1 0 2 2 0 2
Consensus N W H D N T A T H W W D V W A N H W H

Sequence Logo

Motif List

Motif AccMotif NameBinding SequenceStartEndOrientationPubMed-ID
MF097716 aprE operon
AGTTTATTTTTCAGAATACTTTTATCATCA
1105921 1105950 - 1906467
MF097717 aprE operon
CTTTGAAAAAATATCACGATAATATC
1105893 1105918 - 1906467
MF097718 aprE operon
TGATATACCTAAATAGAGATA
1105685 1105705 - 1906467
MF097719 aprE operon
TACTAAAATATTATTCCATCTA
1105640 1105661 - 1906467
MF097721 nprE operon
GAATGCTAGTTTAATATAACAAT
1541639 1541661 - 1906467
MF097722 nprE operon
CTTGATATTATTCAACAAAAACAAAC
1541717 1541742 - 1906467
MF097736 sinI operon
TAATAAAGGTATATTGGAAAAAAA
2552314 2552337 + 11751836
MF097737 sinI operon
ATCTGCAAAATAATATTTCAAGCTAACTTT
2552238 2552267 + 11751836