Details for MX000051

General Information

MX000051

IolR

BSU39770

Bacillus subtilis subsp. subtilis str. 168 chromosome, complete genome.

NCBI GenBank BacDive

Frequency Matrix

A 0 0 1 0 2 1 3 2 0 1 0 1 1 1 0 2 1 0 0 1 1 0 0 2 1 1 1 2 1 0 2 1 0 1 3 1 0 2 3 2 0 2 1 0 0 2 2 2 2 2 0 0 2 1 0 0 1 0 0 0 0 1 1 1 1 1 0 3 1 3 0 0 0 1 0 0 0
T 2 2 0 0 1 2 0 1 0 0 2 1 1 2 2 0 1 1 1 1 1 1 3 1 1 2 1 1 2 3 1 1 2 0 0 0 1 1 0 0 3 0 1 2 1 0 1 1 1 1 0 3 1 1 2 0 1 2 2 3 2 2 1 1 1 2 1 0 1 0 3 2 2 2 3 0 2
G 1 1 2 0 0 0 0 0 2 1 1 0 1 0 0 0 0 1 1 1 1 2 0 0 1 0 0 0 0 0 0 1 0 0 0 1 1 0 0 0 0 1 1 0 1 0 0 0 0 0 2 0 0 1 0 2 1 1 1 0 1 0 1 0 1 0 2 0 0 0 0 1 1 0 0 3 0
C 0 0 0 3 0 0 0 0 1 1 0 1 0 0 1 1 1 1 1 0 0 0 0 0 0 0 1 0 0 0 0 0 1 2 0 1 1 0 0 1 0 0 0 1 1 1 0 0 0 0 1 0 0 0 1 1 0 0 0 0 0 0 0 1 0 0 0 0 1 0 0 0 0 0 0 0 1
Consensus T T G C A T A A G V T H D T T A H B B D D G T A D T H A T T A D T C A V B A A A T A D T B A A A A A G T A D T G D T T T T T D H D T G A H A T T T T T G T

Sequence Logo

Motif List

Motif AccMotif NameBinding SequenceStartEndOrientationPubMed-ID
MF097748 iolRS operon
TTGCAAAAGATATACACCGATGTTATCATTTTTAAGCAACTATTGATTAACTTTTGGTTTTTATTATATATTTATGT
4084692 4084768 + 9887260
MF097749 iolA operon
TTTATGATTGACTTATGGGTATTATGCGATTAGAATATAACCAAGAAATGACCAAAAAGTAACCTGTTGTGCATGAAATGGTTGCTTGTAT
4084526 4084616 - 9887260
MF097750 iolT operon (ydjk operon)
AGATATAACAAAAATGTCACTATAACATCACTACAATTGAACTATTAAGTGACTAATAAATACCAAATGAACGAGGTTATGCACA
676154 676238 + 11807058