Details for MX000053

General Information

MX000053

LicT

BSU39080

Bacillus subtilis subsp. subtilis str. 168 chromosome, complete genome.

NCBI GenBank BacDive

Frequency Matrix

A 0 0 0 0 0 0 0 0 1 0 0 0 1 0 1 3 1 0 3 1 0 2 3 1 4 3 1 0 0
T 0 0 4 3 4 3 1 1 0 3 1 0 3 4 3 0 1 0 0 0 3 0 0 0 0 0 3 0 0
G 4 4 0 0 0 1 3 0 0 0 3 1 0 0 0 0 1 1 0 3 1 1 0 0 0 1 0 0 0
C 0 0 0 1 0 0 0 3 3 1 0 3 0 0 0 1 1 3 1 0 0 1 1 3 0 0 0 4 4
Consensus G G T Y T K K Y M Y K S W T W M N S M R K V M M A R W C C

Sequence Logo

Motif List

Motif AccMotif NameBinding SequenceStartEndOrientationPubMed-ID
MF097846 bglPH operon
GGATTGTTACTGCGAAAGCAGGCAAAACC
4035764 4035792 - 8626332
MF097847 bgls operon
GGATTGTTACTGATAAAGCAGGCAAAACC
4012772 4012800 - 8606172
MF097848 sacB operon
GGTTTGTTACTGATAAAGCAGGCAAGACC
3535830 3535858 + 7883710
MF097849 sacPA operon
GGATTGTGACTGGTAAAGCAGGCAAGACC
3905124 3905152 - 7883710