Details for MX000055

General Information

MX000055

Mta

BSU36600

Bacillus subtilis subsp. subtilis str. 168 chromosome, complete genome.

NCBI GenBank BacDive

Frequency Matrix

A 0 3 0 0 1 0 2 1 0 0 0 2 1 0 1 1 0 3 0 1 0 0
T 0 0 0 2 0 3 0 0 0 0 3 1 0 0 0 1 1 0 2 1 1 1
G 3 0 0 0 0 0 0 0 1 2 0 0 2 1 1 1 2 0 1 1 1 0
C 0 0 3 1 2 0 1 2 2 1 0 0 0 2 1 0 0 0 0 0 1 2
Consensus G A C Y M T M M S S T W R S V D K A K D B Y

Sequence Logo

Motif List

Motif AccMotif NameBinding SequenceStartEndOrientationPubMed-ID
MF097781 bmr operon
GACTCTCCCCTAGGAGGAGGTC
2494593 2494614 + 10200972
MF097782 mta operon
GACCCTAACGTTGCGTGATTGTT
3764934 3764956 - 10200972
MF097783 blt operon
GACTATACGGTAACCATATACC
2716869 2716890 + 10200972