Details for MX000056

General Information

MX000056

MtrB

BSU22770

Bacillus subtilis subsp. subtilis str. 168 chromosome, complete genome.

NCBI GenBank BacDive

Frequency Matrix

A 0 0 1 2 0 0 0 0 1 1 0 0 1 1 1 0 0 1 1 1 1 0 0 1 0 0 0 0 1 0 0 0 0 1 0 0 0 0 1 1 1 1 0 0 0 1 1 0 0 0 1 0 0 0 1 2
T 0 2 0 0 0 1 1 1 1 1 1 1 1 1 1 1 1 0 1 1 1 0 2 0 2 0 0 2 0 1 0 0 2 0 2 1 0 2 0 1 0 0 1 2 1 1 1 0 1 0 0 2 1 0 1 0
G 0 0 0 0 1 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 2 0 0 0 0 0 0 0 0 0 1 0 0 0 0 1 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0
C 2 0 1 0 1 1 1 1 0 0 1 0 0 0 0 1 1 1 0 0 0 2 0 1 0 0 2 0 1 1 2 2 0 1 0 0 2 0 1 0 0 1 1 0 1 0 0 1 1 2 1 0 1 2 0 0
Consensus C T M A S Y Y Y W W Y K W W W Y Y M W W W C T M T G C T M Y C C T M T K C T M W R M Y T Y W W S Y C M T Y C W A

Sequence Logo

Motif List

Motif AccMotif NameBinding SequenceStartEndOrientationPubMed-ID
MF097838 yhaG operon
GAGCATATTATTGGAGGGCAAAAAGCTTAGCAGAGGAGAGCATAGTTATGAAAACAAAAGAGTTAG
1075146 1075211 - 10735881
MF097841 trpEDCFBA operon
TAGAATGAGTTGAGTTAGAGAATAGGGTAGCAGAGAATGAGTTTAGTTGAGCTGAG
2377529 2377584 - 11566991