Details for MX000057

General Information

MX000057

PhoP

BSU29110

Bacillus subtilis subsp. subtilis str. 168 chromosome, complete genome.

NCBI GenBank BacDive

Frequency Matrix

A 2 3 3 6 3 3 7 7 8 2 6 3 7 8 7 10 5 6 6 4 5 5 5 6 4 4 8 13 5 4 8
T 9 4 9 5 8 9 4 7 6 9 6 6 8 4 6 4 5 6 8 5 6 6 9 7 5 4 2 2 7 3 4
G 4 6 3 1 1 2 0 1 1 1 0 3 0 2 1 0 3 1 0 1 3 2 1 0 4 4 3 0 3 4 2
C 1 3 1 4 4 2 5 1 1 4 4 4 1 2 2 2 3 3 2 6 2 3 1 3 3 4 3 1 1 5 2
Consensus K N N N N N H W W Y H N W N W W N N W N N N W W N N N A N N N

Sequence Logo

Motif List

Motif AccMotif NameBinding SequenceStartEndOrientationPubMed-ID
MF097590 phoD operon
ttgtttttttaagatcatgtgaagaaaaa
283321 283351 + 10094677
MF097738 phoB operon
TCTTGTAAATCCAATCTTTAAAATCGATTAATACTAGCTTAACAGTTTAAAAATATAATT
621528 621587 - 9335276
MF097739 phoD operon
tcagcgcTTACAAtcagTTCACActtcTTCACAgtcgtTTAACAatgat
283919 283967 + 10094677
MF097740 ykoL operon
TAAATTCTTTACATTAGATTCATACCACGTTCATT
1398097 1398131 + 10671441
MF097741 resA operon
CGCTTTCTAAATttcacaTAACCttcaaaaAGTAAGAAATGTGAAATGAACGTGCAATGATATAATT
2421381 2421447 - 9988472
MF097764 resD operon
gcgacacagttctcaaactttctcacgatttgataaaatgaaagtaacagaaggaaagcagggggaaaacatggaccaaacgaacgaaacaaaaatattagtagttgatgacgaagccagaattcgccgccttttaagaatgtatcttgaacgtgaaaattatgctataga
2417030 2417207 - 9988472
MF097765 tagA operon
GAGACTATTCACAATATTCCTTATGTTAACAGTAACT
3681379 3681415 + 9611818
MF097766 tagA operon
GGTTTTTAACTATATAAATAGAATCTTAAAGGAAGGAGG
3681323 3681361 + 9457886
MF097767 tagA operon
GGAAACATATTTAAATTTAATGTAAAGATAATGTTAATCCTTTGTTGAAGATTTATGTTAAAATATAAGGTAGCTTGATTTTGCTT
3681225 3681310 + 9457886
MF097768 tagD operon
AGTCTGAGTGTAATTACATATTTTGGAATGTTTTTCTCCTCATGAGTACTTAACCTTTTTT
3681115 3681175 - 9457886
MF097769 tagD operon
TGTTTTTAATAGTGTTTAACATTAGGAAGGA
3680983 3681013 - 9457886
MF100143 tuaA operon
9611818
MF100289 phoA operon
9611818
MF100365 tuaA operon
9611818
MF100434 pstS operon
9611818