Details for MX000061

General Information

MX000061

PyrR

BSU15470

Bacillus subtilis subsp. subtilis str. 168 chromosome, complete genome.

NCBI GenBank BacDive

Frequency Matrix

A 0 0 0 0 1 3 3 1 0 2 1 0 1 0 2 1 3 0 3
T 1 3 3 2 1 0 0 0 0 0 1 3 0 1 0 0 0 0 0
G 0 0 0 1 1 0 0 2 1 1 1 0 0 0 1 2 0 3 0
C 2 0 0 0 0 0 0 0 2 0 0 0 2 2 0 0 0 0 0
Consensus Y T T K D A A R S R D T M Y R R A G A

Sequence Logo

Motif List

Motif AccMotif NameBinding SequenceStartEndOrientationPubMed-ID
MF097842 pyr operon
ATTCTTTAAAACAGTCCAGAGAGGCTGAGAAGGAT
1618163 1618197 + 8962074
MF097843 pyr operon
cacctttttaagggcaatccagagaggttgcaaagaggtg
1618259 1618296 + 8962074
MF097845 pyr operon
NA
1619756 1619774 + 7868607