Details for MX000062

General Information

MX000062

RocR

BSU40350

Bacillus subtilis subsp. subtilis str. 168 chromosome, complete genome.

NCBI GenBank BacDive

Frequency Matrix

A 1 1 0 0 0 2 2 2 1 0 1 2 0 0 0 0 0 0 1 0 0
T 1 0 0 0 0 0 0 0 1 2 1 0 2 2 2 2 0 0 0 2 2
G 0 0 0 2 0 0 0 0 0 0 0 0 0 0 0 0 2 0 1 0 0
C 0 1 2 0 2 0 0 0 0 0 0 0 0 0 0 0 0 2 0 0 0
Consensus W M C G C A A A W T W A T T T T G C R T T

Sequence Logo

Motif List

Motif AccMotif NameBinding SequenceStartEndOrientationPubMed-ID
MF097856 rocABC operon
TCCGCAAAATAATTTTGCATT
3880708 3880728 - 8113162
MF097857 rocABC operon
AACGCAAAATAAATTTGCGTT
3880664 3880684 - 8113162