Details for MX000063

General Information

MX000063

SenS

BSU08810

Bacillus subtilis subsp. subtilis str. 168 chromosome, complete genome.

NCBI GenBank BacDive

Frequency Matrix

A 1 1 0 0 0 0 0 1 0 1 0 0 1 1 1 0 1 0 1 0 1
T 0 1 1 1 1 2 1 1 1 0 2 1 0 1 1 2 0 0 1 1 0
G 0 0 1 1 0 0 0 0 1 1 0 0 1 0 0 0 1 1 0 0 0
C 1 0 0 0 1 0 1 0 0 0 0 1 0 0 0 0 0 1 0 1 1
Consensus M W K K Y T Y W K R T Y R W W T R S W Y M

Sequence Logo

Motif List

Motif AccMotif NameBinding SequenceStartEndOrientationPubMed-ID
MF097836 senS operon
AAGGCTCTTATCGTTTAGATAAGGGCCTT
959255 959283 + 8510140
MF097837 aprE operon
GGCGGCCGCATCTGATGTCTTTGCTTGGCGAATGTTCATCTTATTTCTTCCTCCCTCTCAATAATTTTTTCATTCTATCCCTTTTCTGTAAAGTTTATTTTTCAGAATACTTTTATCATCATGCTTTGAAAAAATATCACGATAATATCCATTGTTCTCACGGAAGCACACGCAGGTCATTTGAACGAATTTTTTCGACAGGAATTTGCCGGGACTCAGGAGCATTTAACCTAAAAAAG
1105803 1106041 - 1479343