Details for MX000065

General Information

MX000065

SigD

BSU16470

Bacillus subtilis subsp. subtilis str. 168 chromosome, complete genome.

NCBI GenBank BacDive

Frequency Matrix

A 0 0 1 0 2 0 1 3 3 4 1 0 2 2 1 1 3 2 0 1 2 1 1 0 1 2 0 1 0 3 1 3 2 4 3 2 1 2 1 1 1 2 1
T 2 4 1 0 2 0 1 0 0 0 1 0 0 1 0 1 0 1 1 1 1 3 3 0 3 1 1 0 1 0 3 1 0 0 1 1 0 1 2 2 2 0 1
G 1 0 0 1 0 1 2 1 1 0 1 3 1 1 0 2 0 0 3 1 1 0 0 1 0 1 0 0 3 0 0 0 1 0 0 1 1 1 1 1 1 0 1
C 1 0 2 3 0 3 0 0 0 0 1 1 1 0 3 0 1 1 0 1 0 0 0 3 0 0 3 3 0 1 0 0 1 0 0 0 2 0 0 0 0 2 1
Consensus B T H S W S D R R A N S V D M D M H K N D W W S W D Y M K M W W V A W D V D D D D M N

Sequence Logo

Motif List

Motif AccMotif NameBinding SequenceStartEndOrientationPubMed-ID
MF097868 fliHIJ-ylxF operon
CTCCACAAAAGGAAAAAAGAAAACTTTCTATACAAGAGGTGCG
1695162 1695204 + 1828465
MF097869 fliK-ylxG operon
NA
1697698 1697745 + 1828465
MF097870 fliLMY operon
tttacaCTGAAtgcgctatttattgaaCAGATTGaatgttttccgga
1701049 1701095 + 1828465
MF097871 fliLMY operon
gttctGGAAAagatcgcagctttctacCGAAAAatacaaatatttg
1701154 1701199 + 1828465