Details for MX000067

General Information

MX000067

SigE (-10 region)

BSU15320

Bacillus subtilis subsp. subtilis str. 168 chromosome, complete genome.

-10 region

NCBI GenBank BacDive

Frequency Matrix

A 4 5 5 22 0 25 5 14 10 3 6 12
T 9 6 0 1 25 0 7 4 7 19 10 7
G 5 12 0 0 0 0 3 5 2 1 7 5
C 7 2 20 2 0 0 10 2 6 2 2 1
Consensus N N C A T A N N N T N N

Sequence Logo

Motif List

Motif AccMotif NameBinding SequenceStartEndOrientationPubMed-ID
MF097935 spoIVA operon
AAAGGAATGAACCTTTCTCCCTTGCATACAAATAGGGAGAAA
2387822 2387863 - 1729246
MF097936 spoIVA operon
GATGTCATATTCAAATAGGACAACGTCATACACATATAGTGTCC
2387735 2387778 - 1729246
MF097937 spoIID operon
agagTCATATTagcttgtccctgccCATAGACTagactagagt
3777781 3777823 - 1729246
MF097938 usd-spoIIID operon
tttaGCATATTcccaaaagaatgctaATACACTgttacaaacc
3748858 3748900 - 1729246
MF097939 spoIVFAB operon
aaccGAATATTtgccatggacaagaCATATGATgtacaaaccc
2857650 2857692 - 1729246
MF097940 spoVK operon
catgGttTgTccaccccatgtccgtgaATACAaTaagaaataaa
1874033 1874076 + 1729246
MF097941 cotE operon
taagTAAagTTtctaggcacccctgCATACAaTggaacagaaa
1774933 1774975 + 1729246
MF097942 cotE operon
aaatGCAcAcTagacaaatgcccagCATAagaTaacacgaaga
1775003 1775045 + 1729246
MF097943 spoIVCB operon
acagaCAcAgacagcctcccggtcaCATACAtttacatatagg
2652919 2652961 + 1729246
MF097944 glgBCDAP operon
cttcGAATAaatactataaatgaaaacTAtgaTgtcagaaa
3171657 3171697 - 1729246
MF097945 spoIIIAA operon
cttgTCATAAAgtctgcctcacatCATACATTttaaagaagc
2537640 2537681 - 1729246
MF097946 spoVB operon
cttgtcATGCTTggacgacatatacgCATATCTTtattgtata
2829486 2829528 + 1729246
MF097947 bofA operon
agtggtCTAAACtcctggatcttctCATAAGCTtgtactag
29705 29745 + 1729246
MF097951 spoIIP operon
acagttCTACTTcctctagcttgttCATAGAGTaattactagac
2634461 2634504 - 8990290
MF097952 cotJ operon
ttagtcATAaTCatgcctcctgcctCATAcCtAttaaggtcatt
755839 755882 + 8990290
MF097953 cotH operon
ttaaaaATATGTtaaggatgaagatcCTTACTACcctcatagtac
3717178 3717222 - 8990290
MF097954 dacB operon
ttattcATAACTgatggacatgcgCATAAACTtgtacaaacca
2424552 2424594 - 8990290
MF097955 spoVD operon
atcgttCTACCTgtccaaattcaggCATAAAATgaaacaagcct
1584149 1584192 + 8990290
MF097956 spoVE operon
ggtgacATGTTTatagatgccgtgCATATGCTtaagtaagggc
1590218 1590260 + 8990290
MF097957 spoVM operon
gaggtaCTTTTTcgtttgcaaaaggCATATTAAtaatgataaga
1655319 1655362 + 8990290
MF097958 spoVID operon
ccactcATATTTtctccagttcataCATACACCtttagtgacat
2872786 2872829 - 8990290
MF097959 exuP2 operon
taaagaATATTTaaaataatttgtaAATAAAATgtgtttgtagg
1303329 1303372 + 8990290
MF097960 yknT operon
agaggaATAGCTgttcagtatttgCATATTGTagtgttaacat
1495388 1495430 - 8990290
MF097961 yteV operon
tctatcATAACGctgttccaaacggAATAGATTgatagagaaag
3078589 3078632 - 8990290
MF097962 mmgABCDE operon
tcatTCATTCATgcccgtttcaaagCATACATTcatagaagac
2514089 2514131 - 8759838