Details for MX000070

General Information

MX000070

SigE (38-mer)

BSU15320

Bacillus subtilis subsp. subtilis str. 168 chromosome, complete genome.

(-35 region)-N15-(-10 region)

NCBI GenBank BacDive

Frequency Matrix

A 1 1 2 1 2 2 0 2 0 1 0 1 1 2 0 1 3 0 2 1 2 0 2 0 0 1 2 0 4 0 1 2 0 2 3 0 2
T 2 2 0 1 1 1 4 0 3 1 3 1 1 0 1 0 1 2 0 2 0 2 1 2 1 0 1 4 0 2 2 2 2 1 0 3 1
G 1 1 2 1 0 0 0 2 0 1 0 2 1 1 1 2 0 1 2 0 1 1 1 1 2 0 0 0 0 0 0 0 1 0 0 1 0
C 0 0 0 1 1 1 0 0 1 1 1 0 1 1 2 1 0 1 0 1 1 1 0 1 1 3 1 0 0 2 1 0 1 1 1 0 1
Consensus D D R N H H T R Y N Y D N V B V W B R H V B D B B M H T A Y H W B H M K H

Sequence Logo

Motif List

Motif AccMotif NameBinding SequenceStartEndOrientationPubMed-ID
MF097936 spoIVA operon
GATGTCATATTCAAATAGGACAACGTCATACACATATAGTGTCC
2387735 2387778 - 1729246
MF097940 spoVK operon
catgGttTgTccaccccatgtccgtgaATACAaTaagaaataaa
1874033 1874076 + 1729246
MF097946 spoVB operon
cttgtcATGCTTggacgacatatacgCATATCTTtattgtata
2829486 2829528 + 1729246
MF097953 cotH operon
ttaaaaATATGTtaaggatgaagatcCTTACTACcctcatagtac
3717178 3717222 - 8990290