Details for MX000071

General Information

MX000071

SigB (-10 region)

BSU04730

Bacillus subtilis subsp. subtilis str. 168 chromosome, complete genome.

-10 region

NCBI GenBank BacDive

Frequency Matrix

A 18 14 10 0 3 25 42 19 18 17 18 22
T 10 5 6 0 0 17 2 16 15 11 14 17
G 11 16 28 45 40 1 1 7 7 12 9 2
C 6 10 1 0 2 2 0 3 5 5 4 4
Consensus N N R G G W A N N N N W

Sequence Logo

Motif List

Motif AccMotif NameBinding SequenceStartEndOrientationPubMed-ID
MF097865 yvyD operon
ATTTATGTTTCAGCAGGAATTGTAAAGGGTAA
3631618 3631649 - 9852014
MF097892 yaaIH operon
ttcaaaGTTTTTtcattgcctaaaaaGGCTAcatattaact
25795 25835 - 11717291
MF097893 ybyB operon
caacagGTTTAgcaatttccaaaacGGGAATgatacagga
231113 231152 - 11717291
MF097894 ycbP operon
aataagGTTTAActttttacatttgaGGAATtatacataa
282185 282224 - 11717291
MF097895 ydaB operon
gaaataGTTTTAcaagttatcttttttGGGTtAaaatgggtg
469324 469365 + 11717291
MF097896 ydaC operon
aaaaatGTTTcAcatggaacgctgagaGGAAAttaactcaa
471573 471613 - 11717291
MF097897 ydaJKLMN operon
ggtcctGTTTTcttaatgttcaaaaaGGGAAAaaaaagcta
478785 478825 + 11717291
MF097898 ydbD operon
tttttcGTTTATctttctatcgatcGGAAAtataaaaag
496588 496626 - 11717291
MF097899 ydgC operon
atactcGTgagTaacattactcgtGGGTATtatttttgg
602962 603000 + 11717291
MF097900 yerD operon
gctattGTTTggaaagtgttctactgtGGAAatggttacat
718376 718416 - 11717291
MF097901 yfhFED operon
aaacgcGTTTTcttttattacaatgaGGTAAagtatattt
925570 925609 - 11717291
MF097902 yfkED operon
tacaacGTTTTccaaaagcaggcaacctGaAAAaagcctata
865075 865116 + 11717291
MF097903 yfkJIH operon
atgaagGTTTcTttttagagaaatagGGGcAAagaataggg
861951 861991 + 11717291
MF097904 yflS operon
aacttaGTTaAggagtagaatggaaaaGGGgATcggaaaaca
829317 829358 + 11717291
MF097905 ygxB operon
ccaaatGTaTAAataatttcagccGGGcAgatttcatat
1015739 1015777 - 11717291
MF097906 yhaS operon
cataaaGTTTTAtatagtgaaaaagaaGGGAtAtcttgATGa
1061323 1061364 - 11717291
MF097907 yhcM operon
tataacGgTTAAtttgtctaacgaggGGGAAAatatgaata
988891 988931 - 11717291
MF097908 yheK operon
ggaaaaGgTTAATTGtgctcaaattcGGGTAgtagtgttgt
1044899 1044939 - 11717291
MF097909 yhxD operon
NA
1118136 1118176 - 11717291
MF097910 yjgCD operon
ttgtatGTTTTAttgagttgttgtaaGGGAActgaaatagg
1285515 1285555 + 11717291
MF097911 yocB operon
agtcagGTTTgAtcgtttttaagagaGGaAAAagaaaacta
2087550 2087590 - 11717291
MF097912 ypuD operon
tttacgGTTTTTtattcatgaaaaaaaGGAAtaactcatat
2432117 2432157 - 11717291
MF097913 yqgZ operon
taaatgGTTTAAatgaaaaatgatccGGGTAgttattctac
2564439 2564479 - 11717291
MF097914 yqhB operon
acacatGTTTTAtgagcattttcaggtGGTATggaatgtag
2561520 2561560 + 11717291
MF097915 ytaG operon
NA
3162257 3162298 + 11717291
MF097916 yunG operon
gttctaGTTTTTaaaatctcatcaacgtGGTATcttttttta
3327166 3327207 - 11717291
MF097917 yuzA operon
ataactGTTTTAAtaattcatggaGGAggttgcaaaac
3224826 3224863 + 11717291
MF097918 yvaA operon
agttagGTTTTAccatttgatcaggaGGGTATatacttctg
3444288 3444328 + 11717291
MF097919 yvaG operon
caatcaGaTTTctgtcaataaataagaGGAATcaaaaacgg
3450538 3450578 - 11717291
MF097920 yvaK operon
caaaacGTTTTTttctgattaaactgtGGAAAactaaaatg
3454991 3455031 - 11717291
MF097921 yvbG operon
ataaagGTTTAccgggaaatcgcctccGGGTAAaagggtgga
3472521 3472562 - 11717291
MF097922 yvgN operon
ttaagcGtaTTAttggtatcggctgagaGGAATgtgagataa
3427619 3427660 - 11717291
MF097923 yvgO operon
tattgagattacaaatacattgagcagggtatgcgtgtagt
3426792 3426832 + 11717291
MF097924 yvgW operon
gtttttGTTTTTcattgacactttcttGGaAAAcaacatata
3441061 3441102 - 11717291
MF097925 yvgZYX operon
acaaccGTTTggacaatcagtataatGGGAATtaatatcat
3444219 3444259 - 11717291
MF097926 ywdD operon
tcatctGTTTcgctcttttcaggaaGGAAAgagtgagga
3900352 3900390 - 11717291
MF097927 ywiE operon
tacaagGTTTATcgattagaaaaaagaGGTAAtacagaggt
3823100 3823140 - 11717291
MF097928 ywsC operon
agagaaGTTTggcttagtcgattaGGGAAgattatgtta
3700711 3700749 - 11717291
MF097929 ywtG operon
aaaaagGTTTAAtggccggaaaaagaGGcTAAaagatttct
3693962 3694002 - 11717291
MF097930 yxbG operon
tcgcatGTTTATcactgcacatagcGGGAAgacaaataga
4091787 4091826 + 11717291
MF097931 yxlJ operon
acagccGTTTTTtttgatctgcttcGGGAATggtacaatg
3964900 3964939 - 11717291
MF097932 yxzF operon
tagcatGTTTAAggaagaggcaatcagGGGAATGgttgagaa
3964239 3964280 - 11717291
MF097933 yxnA operon
caaaaggggtaagacccttccggatggggtaatgtacaaaa
4107199 4107239 + 11717291
MF097934 yycE operon
cttgggGTTTTTttcattcgaaagatGGAAgaaatgacgt
4157416 4157455 - 11717291
MF100387 yjcE operon
11717291