Details for MX000073

General Information

MX000073

SigB (32-mer)

BSU04730

Bacillus subtilis subsp. subtilis str. 168 chromosome, complete genome.

(-35 region)-N14-(-10 region)

NCBI GenBank BacDive

Frequency Matrix

A 13 12 3 0 3 0 0 7 9 4 5 8 3 4 8 6 6 10 11 11 10 8 6 5 1 2 9 19 10 9 8 12
T 3 3 6 1 14 19 19 8 6 11 7 5 8 8 4 10 7 5 2 5 4 4 2 3 0 0 9 0 6 8 4 2
G 0 1 8 19 3 1 1 3 2 1 4 5 5 3 4 4 4 2 3 3 3 6 10 12 19 17 1 1 3 2 5 3
C 4 4 3 0 0 0 0 2 3 4 4 2 4 5 4 0 3 3 4 1 3 2 2 0 0 1 1 0 1 1 3 3
Consensus M N N G W T T N N N N N N N N D N N N N N N N R G G W A N W N N

Sequence Logo

Motif List

Motif AccMotif NameBinding SequenceStartEndOrientationPubMed-ID
MF097865 yvyD operon
ATTTATGTTTCAGCAGGAATTGTAAAGGGTAA
3631618 3631649 - 9852014
MF097896 ydaC operon
aaaaatGTTTcAcatggaacgctgagaGGAAAttaactcaa
471573 471613 - 11717291
MF097897 ydaJKLMN operon
ggtcctGTTTTcttaatgttcaaaaaGGGAAAaaaaagcta
478785 478825 + 11717291
MF097900 yerD operon
gctattGTTTggaaagtgttctactgtGGAAatggttacat
718376 718416 - 11717291
MF097903 yfkJIH operon
atgaagGTTTcTttttagagaaatagGGGcAAagaataggg
861951 861991 + 11717291
MF097907 yhcM operon
tataacGgTTAAtttgtctaacgaggGGGAAAatatgaata
988891 988931 - 11717291
MF097908 yheK operon
ggaaaaGgTTAATTGtgctcaaattcGGGTAgtagtgttgt
1044899 1044939 - 11717291
MF097909 yhxD operon
NA
1118136 1118176 - 11717291
MF097911 yocB operon
agtcagGTTTgAtcgtttttaagagaGGaAAAagaaaacta
2087550 2087590 - 11717291
MF097912 ypuD operon
tttacgGTTTTTtattcatgaaaaaaaGGAAtaactcatat
2432117 2432157 - 11717291
MF097913 yqgZ operon
taaatgGTTTAAatgaaaaatgatccGGGTAgttattctac
2564439 2564479 - 11717291
MF097914 yqhB operon
acacatGTTTTAtgagcattttcaggtGGTATggaatgtag
2561520 2561560 + 11717291
MF097918 yvaA operon
agttagGTTTTAccatttgatcaggaGGGTATatacttctg
3444288 3444328 + 11717291
MF097919 yvaG operon
caatcaGaTTTctgtcaataaataagaGGAATcaaaaacgg
3450538 3450578 - 11717291
MF097920 yvaK operon
caaaacGTTTTTttctgattaaactgtGGAAAactaaaatg
3454991 3455031 - 11717291
MF097923 yvgO operon
tattgagattacaaatacattgagcagggtatgcgtgtagt
3426792 3426832 + 11717291
MF097925 yvgZYX operon
acaaccGTTTggacaatcagtataatGGGAATtaatatcat
3444219 3444259 - 11717291
MF097927 ywiE operon
tacaagGTTTATcgattagaaaaaagaGGTAAtacagaggt
3823100 3823140 - 11717291
MF097929 ywtG operon
aaaaagGTTTAAtggccggaaaaagaGGcTAAaagatttct
3693962 3694002 - 11717291
MF097933 yxnA operon
caaaaggggtaagacccttccggatggggtaatgtacaaaa
4107199 4107239 + 11717291